Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HTR3D cdna clone

HTR3D cDNA Clone

Gene Names
HTR3D; 5HT3D
Synonyms
HTR3D; HTR3D cDNA Clone; HTR3D cdna clone
Ordering
For Research Use Only!
Sequence
ATGGTGGCCATCAGGCGCAGGTGCAGGCCCAGCCCCTACGTGGTAAACTTTCTGGTGCCCAGTGGCATTCTGATTGCCATCGATGCCCTCAGTTTCTACCTGCCACTGGAAAGTGGGAATTGTGCCCCATTCAAGATGACTGTTCTGCTGGGCTACAGCGTCTTCCTGCTCATGATGAATGACTTGCTCCCAGCCACTAGCACTTCATCACATGCTTCACTAGTACGTCCTCATCCATCAAGAGACCAAAAGCGAGGTGTCTACTTCGCCCTGTGCCTGTCCCTGATGGTGGGCAGCCTGCTGGAGACCATCTTCATCACCCACCTGCTGCACGTGGCCACCACCCAGCCCCTACCTCTGCCTCGGTGGCTCCACTCCCTGCTGCTGCACTGCACCGGCCAAGGGAGATGCTGTCCCACTGCGCCCCAGAAGGGAAATAAGGGCCCGGGTCTCACCCCCACCCACCTGCCCGGTGTGAAGGAGCCAGAGGTATCAGCAGGGCAGATGCCAGGCCCTGGGGAGGCAGAGCTGACAGGGGGCTCAGAATGGACAAGGGCCCAGCGGGAACACGAGGCCCAGAAGCAGCACTCGGTGGAGCTGTGGGTGCAGTTCAGCCACGCGATGGACGCCCTGCTCTTCCGCCTCTACCTGCTCTTCATGGCCTCCTCCATCATCACCGTCATATGCCTCTGGAACACCTAG
Sequence Length
702
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,145 Da
NCBI Official Full Name
Homo sapiens 5-hydroxytryptamine (serotonin) receptor 3 family member D, mRNA
NCBI Official Synonym Full Names
5-hydroxytryptamine receptor 3D
NCBI Official Symbol
HTR3D
NCBI Official Synonym Symbols
5HT3D
NCBI Protein Information
5-hydroxytryptamine receptor 3D
UniProt Protein Name
5-hydroxytryptamine receptor 3D
UniProt Gene Name
HTR3D
UniProt Synonym Gene Names
5-HT3-D; 5-HT3D
UniProt Entry Name
5HT3D_HUMAN

NCBI Description

The protein encoded this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit D of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a mitogen and a hormone. This hormone has been linked to neuropsychiatric disorders, including anxiety, depression, and migraine. Serotonin receptors causes fast and depolarizing responses in neurons following activation. The genes encoding subunits C, D and E of this type 3 receptor form a cluster on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]

Uniprot Description

5-HT(3D): This is one of the several different receptors for 5- hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor is a ligand-gated ion channel, which when activated causes fast, depolarizing responses. It is a cation-specific, but otherwise relatively nonselective, ion channel. Belongs to the ligand-gated ion channel (TC 1.A.9) family. 5-hydroxytryptamine receptor (TC 1.A.9.2) subfamily. HTR3D sub-subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Channel, ligand-gated; Transporter, ion channel; Channel, cation; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 3q27.1

Cellular Component: nicotinic acetylcholine-gated receptor-channel complex; plasma membrane

Molecular Function: acetylcholine binding; acetylcholine receptor activity; nicotinic acetylcholine-activated cation-selective channel activity; protein binding; serotonin receptor activity; serotonin-activated cation-selective channel activity

Biological Process: synaptic transmission, cholinergic

Research Articles on HTR3D

Similar Products

Product Notes

The HTR3D htr3d (Catalog #AAA1276350) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGTGGCCA TCAGGCGCAG GTGCAGGCCC AGCCCCTACG TGGTAAACTT TCTGGTGCCC AGTGGCATTC TGATTGCCAT CGATGCCCTC AGTTTCTACC TGCCACTGGA AAGTGGGAAT TGTGCCCCAT TCAAGATGAC TGTTCTGCTG GGCTACAGCG TCTTCCTGCT CATGATGAAT GACTTGCTCC CAGCCACTAG CACTTCATCA CATGCTTCAC TAGTACGTCC TCATCCATCA AGAGACCAAA AGCGAGGTGT CTACTTCGCC CTGTGCCTGT CCCTGATGGT GGGCAGCCTG CTGGAGACCA TCTTCATCAC CCACCTGCTG CACGTGGCCA CCACCCAGCC CCTACCTCTG CCTCGGTGGC TCCACTCCCT GCTGCTGCAC TGCACCGGCC AAGGGAGATG CTGTCCCACT GCGCCCCAGA AGGGAAATAA GGGCCCGGGT CTCACCCCCA CCCACCTGCC CGGTGTGAAG GAGCCAGAGG TATCAGCAGG GCAGATGCCA GGCCCTGGGG AGGCAGAGCT GACAGGGGGC TCAGAATGGA CAAGGGCCCA GCGGGAACAC GAGGCCCAGA AGCAGCACTC GGTGGAGCTG TGGGTGCAGT TCAGCCACGC GATGGACGCC CTGCTCTTCC GCCTCTACCT GCTCTTCATG GCCTCCTCCA TCATCACCGT CATATGCCTC TGGAACACCT AG. It is sometimes possible for the material contained within the vial of "HTR3D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.