HTATSF1 cdna clone
HTATSF1 cDNA Clone
Gene Names
HTATSF1; TATSF1; TAT-SF1; dJ196E23.2
Synonyms
HTATSF1; HTATSF1 cDNA Clone; HTATSF1 cdna clone
Sequence
atgagcggcaccaacttggatgggaacgatgagtttgatgagcagttgcgaatgcaagaattgtacggagacggcaaggatggtgacacccagaccgatgccggcggagaacccgattctctcgggcagcagccgacggacactccctacgagtgggacctggacaaaaaggcttggttccccaagattactgaagatttcattgctacatatcaggccaattatggcttctctaacgatggcgcatctagttctaccgcaaatgttgaagatgtccatgctaggactgcagaggaacctccacaagaaaaagccccggaacccactgatgccagaaagaagggagaaaaaagaaaggctgagtcaggatggtttcatgttgaagaagacagaaatacaaatgtatacgtgtctggtttgcctccagatattacagtggatgaatttatacaacttatgtccaagtttggcattattatgagagatcctcagacagaagaatttaaggtcaaactttacaaagataatcaaggaaatcttaaaggagacggtctttgctgttatttgaaaagagaatctgtggaacttgcattaaaacttttggatgaagatgaaattagaggctacaaattacatgttgaggtggcaaagtttcaactgaagggagaatatgatgcctcaaagaagaagaagaagtgcaaagactataagaagaagctgtctatgcaacaaaagcagttggattggagacctgagaggcgagccggaccatcccggatgcgccatgagcgagttgtcatcatcaagaatatgtttcatcctatggattttgaggatgatccgttggtgctgaatgagatcagagaagaccttcgagtagagtgttcgaagtttggacaaattaggaaactccttctctttgataggcacccagatggtgtggcctctgtgtcctttcgggatccagaggaagctgattattgtattcagactctcgatggaagatggtttggtggccgtcaaatcactgcccaggcatgggatgggactacagattatcaggtggaggaaacctcaagagaaagggaggaaaggctgagaggatgggaggctttcctcaatgctcctgaggccaacagaggccttaggcgttcagattctgtctctgcttccgaaagggcagggccttctagagcaaggcatttttcagagcaccccagcacatctaaaatgaatgctcaagaaactgcaactggaatggcgtttgaagaacctatagatgagaagaagtttgaaaagacagaagatgggggagaatttgaagaaggtgcttctgaaaacaatgctaaggaaagtagccccgaaaaagaggctgaagaaggctgccctgaaaaagaatctgaagagggctgccccaaaagagggtttgaaggcagctgctcccaaaaagagtctgaagaaggcaatcccgtaagaggatctgaagaggatagtcctaaaaaagagtctaaaaagaagacactcaaaaatgattgtgaagagaatggccttgcaaaggaatctgaagatgacctcaacaaggagtctgaagaggaggttggccccacaaaagagtccgaagaagatgactcagagaaagagtctgatgaagactgctctgaaaaacagtctgaagatggctccgaaagagaatttgaagaaaatggtctcgagaaagatttggacgaggaaggttctgaaaaggagcttcatgaaaatgttcttgacaaagagttagaagaaaatgactctgaaaactccgaatttgaagatgacggctctgaaaaagtgttagatgaggaaggctctgagagagagtttgacgaagattcagatgaaaaggaagaagaggaggatacatatgaaaaagtatttgatgatgagtctgatgagaaagaggatgaagaatatgcagatgaaaaggggcttgaagctgctgataaaaaggcggaagaaggtgatgcagatgaaaagctgtttgaagagtcagatgacaaggaagatgaagatgcagatggaaaggaagttgaagatgctgacgaaaagttgttcgaagatgatgattccaatgagaagttgtttgatgaggaggaagattccagtgagaagttgtttgacgattctgatgagagggggactttgggtggttttgggagtgttgaagaagggcccctatccactggcagcagctttattctcagtagcgatgatgatgacgatgatatttaa
Sequence Length
2268
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
85,853 Da
NCBI Official Full Name
Homo sapiens HIV-1 Tat specific factor 1, mRNA
NCBI Official Synonym Full Names
HIV-1 Tat specific factor 1
NCBI Official Symbol
HTATSF1
NCBI Official Synonym Symbols
TATSF1; TAT-SF1; dJ196E23.2
NCBI Protein Information
HIV Tat-specific factor 1
UniProt Protein Name
HIV Tat-specific factor 1
Protein Family
UniProt Gene Name
HTATSF1
UniProt Synonym Gene Names
Tat-SF1
UniProt Entry Name
HTSF1_HUMAN
NCBI Description
The protein encoded by this gene functions as a cofactor for the stimulation of transcriptional elongation by HIV-1 Tat, which binds to the HIV-1 promoter through Tat-TAR interaction. This protein may also serve as a dual-function factor to couple transcription and splicing and to facilitate their reciprocal activation. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Sep 2009]
Uniprot Description
TAT-SF1: Functions as a general transcription factor playing a role in the process of transcriptional elongation. May mediate the reciprocal stimulatory effect of splicing on transcriptional elongation. In case of infection by HIV-1, it is up-regulated by the HIV-1 proteins NEF and gp120, acts as a cofactor required for the Tat-enhanced transcription of the virus. Belongs to the HTATSF1 family.
Protein type: Transcription, coactivator/corepressor; Spliceosome
Chromosomal Location of Human Ortholog: Xq26.3
Cellular Component: nucleoplasm; nucleus; snRNP U2
Molecular Function: RNA binding
Biological Process: nuclear mRNA splicing, via spliceosome; regulation of RNA elongation; regulation of transcription from RNA polymerase II promoter; viral genome replication
Research Articles on HTATSF1
Similar Products
Product Notes
The HTATSF1 htatsf1 (Catalog #AAA1270847) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcggca ccaacttgga tgggaacgat gagtttgatg agcagttgcg aatgcaagaa ttgtacggag acggcaagga tggtgacacc cagaccgatg ccggcggaga acccgattct ctcgggcagc agccgacgga cactccctac gagtgggacc tggacaaaaa ggcttggttc cccaagatta ctgaagattt cattgctaca tatcaggcca attatggctt ctctaacgat ggcgcatcta gttctaccgc aaatgttgaa gatgtccatg ctaggactgc agaggaacct ccacaagaaa aagccccgga acccactgat gccagaaaga agggagaaaa aagaaaggct gagtcaggat ggtttcatgt tgaagaagac agaaatacaa atgtatacgt gtctggtttg cctccagata ttacagtgga tgaatttata caacttatgt ccaagtttgg cattattatg agagatcctc agacagaaga atttaaggtc aaactttaca aagataatca aggaaatctt aaaggagacg gtctttgctg ttatttgaaa agagaatctg tggaacttgc attaaaactt ttggatgaag atgaaattag aggctacaaa ttacatgttg aggtggcaaa gtttcaactg aagggagaat atgatgcctc aaagaagaag aagaagtgca aagactataa gaagaagctg tctatgcaac aaaagcagtt ggattggaga cctgagaggc gagccggacc atcccggatg cgccatgagc gagttgtcat catcaagaat atgtttcatc ctatggattt tgaggatgat ccgttggtgc tgaatgagat cagagaagac cttcgagtag agtgttcgaa gtttggacaa attaggaaac tccttctctt tgataggcac ccagatggtg tggcctctgt gtcctttcgg gatccagagg aagctgatta ttgtattcag actctcgatg gaagatggtt tggtggccgt caaatcactg cccaggcatg ggatgggact acagattatc aggtggagga aacctcaaga gaaagggagg aaaggctgag aggatgggag gctttcctca atgctcctga ggccaacaga ggccttaggc gttcagattc tgtctctgct tccgaaaggg cagggccttc tagagcaagg catttttcag agcaccccag cacatctaaa atgaatgctc aagaaactgc aactggaatg gcgtttgaag aacctataga tgagaagaag tttgaaaaga cagaagatgg gggagaattt gaagaaggtg cttctgaaaa caatgctaag gaaagtagcc ccgaaaaaga ggctgaagaa ggctgccctg aaaaagaatc tgaagagggc tgccccaaaa gagggtttga aggcagctgc tcccaaaaag agtctgaaga aggcaatccc gtaagaggat ctgaagagga tagtcctaaa aaagagtcta aaaagaagac actcaaaaat gattgtgaag agaatggcct tgcaaaggaa tctgaagatg acctcaacaa ggagtctgaa gaggaggttg gccccacaaa agagtccgaa gaagatgact cagagaaaga gtctgatgaa gactgctctg aaaaacagtc tgaagatggc tccgaaagag aatttgaaga aaatggtctc gagaaagatt tggacgagga aggttctgaa aaggagcttc atgaaaatgt tcttgacaaa gagttagaag aaaatgactc tgaaaactcc gaatttgaag atgacggctc tgaaaaagtg ttagatgagg aaggctctga gagagagttt gacgaagatt cagatgaaaa ggaagaagag gaggatacat atgaaaaagt atttgatgat gagtctgatg agaaagagga tgaagaatat gcagatgaaa aggggcttga agctgctgat aaaaaggcgg aagaaggtga tgcagatgaa aagctgtttg aagagtcaga tgacaaggaa gatgaagatg cagatggaaa ggaagttgaa gatgctgacg aaaagttgtt cgaagatgat gattccaatg agaagttgtt tgatgaggag gaagattcca gtgagaagtt gtttgacgat tctgatgaga gggggacttt gggtggtttt gggagtgttg aagaagggcc cctatccact ggcagcagct ttattctcag tagcgatgat gatgacgatg atatttaa. It is sometimes possible for the material contained within the vial of "HTATSF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
