HSPA13 cdna clone
HSPA13 cDNA Clone
Gene Names
HSPA13; STCH
Synonyms
HSPA13; HSPA13 cDNA Clone; HSPA13 cdna clone
Sequence
atggccagagagatgacgatcttaggatcggctgttttgactctcctgttggccggctatttggcacaacagtatttaccattgcctactcctaaagtgattggtattgatcttggcaccacctattgttctgttggggtgttttttcctggcacaggaaaagtaaaggtgattccagatgaaaatgggcatatcagcatacccagcatggtgtcttttactgacaatgatgtatatgtgggatatgaaagcgtagagctggcagattcaaatcctcaaaacacaatatatgatgccaaaagattcataggcaagatttttaccgcagaagagttggaggctgaaattggcagatacccatttaaggttttaaacaaaaatggaatggttgagttttctgtgacaagtaatgagaccatcacagtgtccccagaatatgttggctctcgactattgttgaagttaaaggaaatggcagaggcatatcttggaatgccagttgccaatgctgtcatttctgtaccagcagaatttgatctaaaacagagaaattcaacaattgaagctgctaaccttgcaggactgaagattttgagggtaataaatgaacccacagcagcagctatggcctatggtctccacaaggctgacgtcttccacgtcttggtgatagacttgggcggaggaactctagatgtgtctttactgaataaacaaggagggatgtttctaacccgagcaatgtctggaaacaataaacttggaggacaggacttcaatcagagattgcttcagtacttatataaacagatctatcaaacatatggcttcgtgccctctaggaaagaggaaatccacagattgagacaagctgtggaaatggtcaaattaaatctgactcttcatcaatctgctcagttgtcagtattactaacggtggaggagcaggacaggaaggaacctcacagtagtgacactgaactgccaaaagacaaactttcctcagcagatgaccatcgcgtgaacagtgggtttggacgtggcctttctgataagaaaagtggagaaagtcaggttttatttgaaacagaaatatcacggaaactctttgatacccttaatgaagacctctttcagaaaatactggtacccattcagcaagtattgaaagaaggccacctggaaaagactgagattgatgaggtggttttagttgggggctccactcgtattcctcggatccgtcaagtcattcaagagttctttggaaaagatcccaacacatctgtagaccctgacctagcagtagtaacgggagtggctatccaagcagggattgatggaggcttttggcctctccaagtcagtgctttagaaattcccaataagcatttacaaaaaaccaacttcaactga
Sequence Length
1416
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
51,927 Da
NCBI Official Full Name
Homo sapiens heat shock protein 70kDa family, member 13, mRNA
NCBI Official Synonym Full Names
heat shock protein family A (Hsp70) member 13
NCBI Official Symbol
HSPA13
NCBI Official Synonym Symbols
STCH
NCBI Protein Information
heat shock 70 kDa protein 13
UniProt Protein Name
Heat shock 70 kDa protein 13
Protein Family
UniProt Gene Name
HSPA13
UniProt Synonym Gene Names
STCH
UniProt Entry Name
HSP13_HUMAN
NCBI Description
The protein encoded by this gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The encoded protein contains an ATPase domain and has been shown to associate with a ubiquitin-like protein. [provided by RefSeq, Jul 2008]
Uniprot Description
HSPA13: Has peptide-independent ATPase activity. Belongs to the heat shock protein 70 family.
Protein type: Heat shock protein
Chromosomal Location of Human Ortholog: 21q11
Cellular Component: intracellular membrane-bound organelle
Molecular Function: protein binding
Research Articles on HSPA13
Similar Products
Product Notes
The HSPA13 hspa13 (Catalog #AAA1266246) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagag agatgacgat cttaggatcg gctgttttga ctctcctgtt ggccggctat ttggcacaac agtatttacc attgcctact cctaaagtga ttggtattga tcttggcacc acctattgtt ctgttggggt gttttttcct ggcacaggaa aagtaaaggt gattccagat gaaaatgggc atatcagcat acccagcatg gtgtctttta ctgacaatga tgtatatgtg ggatatgaaa gcgtagagct ggcagattca aatcctcaaa acacaatata tgatgccaaa agattcatag gcaagatttt taccgcagaa gagttggagg ctgaaattgg cagataccca tttaaggttt taaacaaaaa tggaatggtt gagttttctg tgacaagtaa tgagaccatc acagtgtccc cagaatatgt tggctctcga ctattgttga agttaaagga aatggcagag gcatatcttg gaatgccagt tgccaatgct gtcatttctg taccagcaga atttgatcta aaacagagaa attcaacaat tgaagctgct aaccttgcag gactgaagat tttgagggta ataaatgaac ccacagcagc agctatggcc tatggtctcc acaaggctga cgtcttccac gtcttggtga tagacttggg cggaggaact ctagatgtgt ctttactgaa taaacaagga gggatgtttc taacccgagc aatgtctgga aacaataaac ttggaggaca ggacttcaat cagagattgc ttcagtactt atataaacag atctatcaaa catatggctt cgtgccctct aggaaagagg aaatccacag attgagacaa gctgtggaaa tggtcaaatt aaatctgact cttcatcaat ctgctcagtt gtcagtatta ctaacggtgg aggagcagga caggaaggaa cctcacagta gtgacactga actgccaaaa gacaaacttt cctcagcaga tgaccatcgc gtgaacagtg ggtttggacg tggcctttct gataagaaaa gtggagaaag tcaggtttta tttgaaacag aaatatcacg gaaactcttt gataccctta atgaagacct ctttcagaaa atactggtac ccattcagca agtattgaaa gaaggccacc tggaaaagac tgagattgat gaggtggttt tagttggggg ctccactcgt attcctcgga tccgtcaagt cattcaagag ttctttggaa aagatcccaa cacatctgta gaccctgacc tagcagtagt aacgggagtg gctatccaag cagggattga tggaggcttt tggcctctcc aagtcagtgc tttagaaatt cccaataagc atttacaaaa aaccaacttc aactga. It is sometimes possible for the material contained within the vial of "HSPA13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
