Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HRASLS5 cdna clone

HRASLS5 cDNA Clone

Gene Names
HRASLS5; RLP1; iNAT; HRLP5; HRSL5
Synonyms
HRASLS5; HRASLS5 cDNA Clone; HRASLS5 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcctgagcccgggcgccgagggggagtacgcgctccgcctccctaggattcccccacccctccccaaacccgcctcgcgaaccgccggtaccgggcccaaggaccagccgcctgcgctcagacgttcagctgtgccccactcagaagaatccgtgggattcgcagcgttggtccagctcccagccaagcagcctccgccgggcacattagaacagggcagaagcatccagcaaggggagaaggctgtagttagcttggagaccacacccagccagaaagcagactggagttcaattccaaagcctgagaatgaaggcaagttaataaagcaagcagctgagggaaaaccaagacccagacctggagacctgattgagatttttcgaattggctatgagcactgggccatctatgtagaagatgattgcgtggtccatctggctcccccaagtgaggagtttgaggtgggcagcattacttccatctttagcaatcgggccgtggtgaaatacagtcgtctggaggatgtgctgcatggctgctcctggaaggtcaataacaagctagatgggacgtacctgcccttgccggtggacaagatcatccagcgtacaaaaaagatggtcaacaagatcgtgcagtacagcctgattgaagggaactgtgagcactttgtcaatggcctcagatatggcgtaccccggagccagcaggtagagcacgccctgatggaaggagcgaaggctgctggagcagttatttcagctgtagtggatagcataaagcccaaaccaataactgcctga
Sequence Length
810
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,288 Da
NCBI Official Full Name
Homo sapiens HRAS-like suppressor family, member 5, mRNA
NCBI Official Synonym Full Names
HRAS like suppressor family member 5
NCBI Official Symbol
HRASLS5
NCBI Official Synonym Symbols
RLP1; iNAT; HRLP5; HRSL5
NCBI Protein Information
Ca(2+)-independent N-acyltransferase
UniProt Protein Name
Ca(2+)-independent N-acyltransferase
UniProt Gene Name
HRASLS5
UniProt Synonym Gene Names
HRLP5; iNAT; HRSL5
UniProt Entry Name
HRSL5_HUMAN

Uniprot Description

HRASLS5: Belongs to the H-rev107 family.

Chromosomal Location of Human Ortholog: 11q13.2

Molecular Function: N-acyltransferase activity

Similar Products

Product Notes

The HRASLS5 hrasls5 (Catalog #AAA1271406) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcctga gcccgggcgc cgagggggag tacgcgctcc gcctccctag gattccccca cccctcccca aacccgcctc gcgaaccgcc ggtaccgggc ccaaggacca gccgcctgcg ctcagacgtt cagctgtgcc ccactcagaa gaatccgtgg gattcgcagc gttggtccag ctcccagcca agcagcctcc gccgggcaca ttagaacagg gcagaagcat ccagcaaggg gagaaggctg tagttagctt ggagaccaca cccagccaga aagcagactg gagttcaatt ccaaagcctg agaatgaagg caagttaata aagcaagcag ctgagggaaa accaagaccc agacctggag acctgattga gatttttcga attggctatg agcactgggc catctatgta gaagatgatt gcgtggtcca tctggctccc ccaagtgagg agtttgaggt gggcagcatt acttccatct ttagcaatcg ggccgtggtg aaatacagtc gtctggagga tgtgctgcat ggctgctcct ggaaggtcaa taacaagcta gatgggacgt acctgccctt gccggtggac aagatcatcc agcgtacaaa aaagatggtc aacaagatcg tgcagtacag cctgattgaa gggaactgtg agcactttgt caatggcctc agatatggcg taccccggag ccagcaggta gagcacgccc tgatggaagg agcgaaggct gctggagcag ttatttcagc tgtagtggat agcataaagc ccaaaccaat aactgcctga. It is sometimes possible for the material contained within the vial of "HRASLS5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.