Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HEY2 cdna clone

HEY2 cDNA Clone

Gene Names
HEY2; GRL; CHF1; HRT2; HERP1; HESR2; bHLHb32; GRIDLOCK
Synonyms
HEY2; HEY2 cDNA Clone; HEY2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagcgcccctgcgaggagacgacctccgagagcgacatggacgagaccatcgacgtggggagcgagaacaattactcggggcaaagtactagctctgtgattagattgaattctccaacaacaacatctcagattatggcaagaaagaaaaggagagggattatagagaaaaggcgtcgggatcggataaataacagtttatctgagttgagaagacttgtgccaactgcttttgaaaaacaaggatctgcaaagttagaaaaagctgaaatattgcaaatgacagtggatcatttgaagatgcttcaggcaacagggggtaaaggctactttgacgcacacgctcttgccatggacttcatgagcataggattccgagagtgcctaacagaagttgcgcggtacctgagctccgtggaaggcctggactcctcggatccgctgcgggtgcggcttgtgtctcatctcagcacttgcgccacccagcgggaggcggcggccatgacatcctccatggcccaccaccatcatccgctccacccgcatcactgggccgccgccttccaccacctgcccgcagccctgctccagcccaacggcctccatgcctcagagtcaaccccttgtcgcctctccacaacttcagaagtgcctcctgcccacggctctgctctcctcacggccacgtttgcccatgcggattcagccctccgaatgccatccacgggcagcgtcgccccctgcgtgccacctctctccacctctctcttgtccctctctgccaccgtccacgccgcagccgcagcagccaccgcggctgcacacagcttccctctgtccttcgcgggggcattccccatgcttcccccaaacgcagcagcagcagtggccgcggccacagccatcagcccgcccttgtcagtatcagccacgtccagtcctcagcagaccagcagtggaacaaacaataaaccttaccgaccctgggggacagaagttggagctttttaa
Sequence Length
1014
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,808 Da
NCBI Official Full Name
Homo sapiens hairy/enhancer-of-split related with YRPW motif 2, mRNA
NCBI Official Synonym Full Names
hes related family bHLH transcription factor with YRPW motif 2
NCBI Official Symbol
HEY2
NCBI Official Synonym Symbols
GRL; CHF1; HRT2; HERP1; HESR2; bHLHb32; GRIDLOCK
NCBI Protein Information
hairy/enhancer-of-split related with YRPW motif protein 2
UniProt Protein Name
Hairy/enhancer-of-split related with YRPW motif protein 2
UniProt Gene Name
HEY2
UniProt Synonym Gene Names
BHLHB32; CHF1; GRL; HERP; HERP1; HRT2; hCHF1; bHLHb32; HESR-2; HRT-2; hHRT2
UniProt Entry Name
HEY2_HUMAN

NCBI Description

This gene encodes a member of the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcription factors. The encoded protein forms homo- or hetero-dimers that localize to the nucleus and interact with a histone deacetylase complex to repress transcription. Expression of this gene is induced by the Notch signal transduction pathway. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

HEY2: Downstream effector of Notch signaling which may be required for cardiovascular development. Transcriptional repressor which binds preferentially to the canonical E box sequence 5'- CACGTG-3'. Represses transcription by the cardiac transcriptional activators GATA4 and GATA6. Belongs to the HEY family.

Chromosomal Location of Human Ortholog: 6q21

Cellular Component: cytoplasm; nucleoplasm; nucleus; Sin3 complex; transcriptional repressor complex

Molecular Function: histone deacetylase binding; protein binding; sequence-specific DNA binding; transcription factor activity

Biological Process: mesenchymal cell development; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; Notch signaling pathway; positive regulation of transcription from RNA polymerase II promoter; vasculogenesis; ventricular cardiac muscle cell development

Research Articles on HEY2

Similar Products

Product Notes

The HEY2 hey2 (Catalog #AAA1275255) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcgcc cctgcgagga gacgacctcc gagagcgaca tggacgagac catcgacgtg gggagcgaga acaattactc ggggcaaagt actagctctg tgattagatt gaattctcca acaacaacat ctcagattat ggcaagaaag aaaaggagag ggattataga gaaaaggcgt cgggatcgga taaataacag tttatctgag ttgagaagac ttgtgccaac tgcttttgaa aaacaaggat ctgcaaagtt agaaaaagct gaaatattgc aaatgacagt ggatcatttg aagatgcttc aggcaacagg gggtaaaggc tactttgacg cacacgctct tgccatggac ttcatgagca taggattccg agagtgccta acagaagttg cgcggtacct gagctccgtg gaaggcctgg actcctcgga tccgctgcgg gtgcggcttg tgtctcatct cagcacttgc gccacccagc gggaggcggc ggccatgaca tcctccatgg cccaccacca tcatccgctc cacccgcatc actgggccgc cgccttccac cacctgcccg cagccctgct ccagcccaac ggcctccatg cctcagagtc aaccccttgt cgcctctcca caacttcaga agtgcctcct gcccacggct ctgctctcct cacggccacg tttgcccatg cggattcagc cctccgaatg ccatccacgg gcagcgtcgc cccctgcgtg ccacctctct ccacctctct cttgtccctc tctgccaccg tccacgccgc agccgcagca gccaccgcgg ctgcacacag cttccctctg tccttcgcgg gggcattccc catgcttccc ccaaacgcag cagcagcagt ggccgcggcc acagccatca gcccgccctt gtcagtatca gccacgtcca gtcctcagca gaccagcagt ggaacaaaca ataaacctta ccgaccctgg gggacagaag ttggagcttt ttaa. It is sometimes possible for the material contained within the vial of "HEY2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.