Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HELLS cdna clone

HELLS cDNA Clone

Gene Names
HELLS; LSH; ICF4; PASG; SMARCA6; Nbla10143
Synonyms
HELLS; HELLS cDNA Clone; HELLS cdna clone
Ordering
For Research Use Only!
Sequence
atgtttggatccagtgagaaagaaacaattgagttaagtcctactggtcgaccaaaacgacgaactagaaaatcaataaattacagcaaaatagatgatttccctaatgaattggaaaaactgatcagtcaaatacagccagaggtggaccgagaaagagctgttgtggaagtgaatatccctgtagaatctgaagttaatctgaagctgcagaatataatgatgctacttcgtaaatgttgtaatcatccatatttgattgaatatcctatagaccctgttacacaagaatttaagatcgatgaagaattggtaacaaattctgggaagttcttgattttggatcgaatgctgccagaactaaaaaaaagaggtcacaaggtgctgcttttttcacaaatgacaagcatgttggacattttgatggattactgccatctcagagatttcaacttcagcaggcttgatgggtccatgtcttactcagagagagaaaaaaacatgcacagcttcaacacggatccagaggtgtttatcttcttagtgagtacacgagctggtggcctgggcattaatctgactgcagcagatacagttatcatttatgatagtgattggaacccccagtcggatcttcaggcccaggatagatgtcatagaattggtcagacaaagccagttgttgtttatcgccttgttacagcaaatactatcgatcagaaaattgtggaaagagcagctgctaaaaggaaactggaaaagttgatcatccataaaaatcatttcaaaggtggtcagtctggattaaatctgtctaagaatttcttagatcctaaggaattaatggaattattaaaatctagagattatgaaagggaaataaaaggatcaagagagaaggtcattagtgataaagatctagagttgttgttagatcgaagtgatcttattgatcaaatgaatgcttcaggaccaattaaagagaagatggggatattcaagatattagaaaattctgaagattccagtcctgaatgtttgttttaa
Sequence Length
1047
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,838 Da
NCBI Official Full Name
Homo sapiens helicase, lymphoid-specific, mRNA
NCBI Official Synonym Full Names
helicase, lymphoid-specific
NCBI Official Symbol
HELLS
NCBI Official Synonym Symbols
LSH; ICF4; PASG; SMARCA6; Nbla10143
NCBI Protein Information
lymphoid-specific helicase
UniProt Protein Name
Lymphoid-specific helicase
UniProt Gene Name
HELLS
UniProt Entry Name
HELLS_HUMAN

NCBI Description

This gene encodes a lymphoid-specific helicase. Other helicases function in processes involving DNA strand separation, including replication, repair, recombination, and transcription. This protein is thought to be involved with cellular proliferation and may play a role in leukemogenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2014]

Uniprot Description

HELLS: Plays an essential role in normal development and survival. Involved in regulation of the expansion or survival of lymphoid cells. Required for de novo or maintenance DNA methylation. May control silencing of the imprinted CDKN1C gene through DNA methylation. May play a role in formation and organization of heterochromatin, implying a functional role in the regulation of transcription and mitosis. By concanavalin-A in peripheral blood leukocytes. Highly expressed in proliferative tissues such as adult thymus and testis, and expressed at lower levels in uterus, small intestine, colon, and peripheral blood mononuclear cells. Also expressed in neoplastic cell lines including those derived from myeloid and lymphoid leukemias. Belongs to the SNF2/RAD54 helicase family. 9 isoforms of the human protein are produced by alternative splicing.

Protein type: Helicase; Apoptosis; EC 3.6.4.-; EC 3.6.1.-

Chromosomal Location of Human Ortholog: 10q24.2

Cellular Component: centric heterochromatin; chromosome, pericentric region

Molecular Function: protein binding

Biological Process: centric heterochromatin formation; lymphocyte proliferation; maintenance of DNA methylation; methylation-dependent chromatin silencing; multicellular organismal development

Disease: Immunodeficiency-centromeric Instability-facial Anomalies Syndrome 4

Research Articles on HELLS

Similar Products

Product Notes

The HELLS hells (Catalog #AAA1277327) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttggat ccagtgagaa agaaacaatt gagttaagtc ctactggtcg accaaaacga cgaactagaa aatcaataaa ttacagcaaa atagatgatt tccctaatga attggaaaaa ctgatcagtc aaatacagcc agaggtggac cgagaaagag ctgttgtgga agtgaatatc cctgtagaat ctgaagttaa tctgaagctg cagaatataa tgatgctact tcgtaaatgt tgtaatcatc catatttgat tgaatatcct atagaccctg ttacacaaga atttaagatc gatgaagaat tggtaacaaa ttctgggaag ttcttgattt tggatcgaat gctgccagaa ctaaaaaaaa gaggtcacaa ggtgctgctt ttttcacaaa tgacaagcat gttggacatt ttgatggatt actgccatct cagagatttc aacttcagca ggcttgatgg gtccatgtct tactcagaga gagaaaaaaa catgcacagc ttcaacacgg atccagaggt gtttatcttc ttagtgagta cacgagctgg tggcctgggc attaatctga ctgcagcaga tacagttatc atttatgata gtgattggaa cccccagtcg gatcttcagg cccaggatag atgtcataga attggtcaga caaagccagt tgttgtttat cgccttgtta cagcaaatac tatcgatcag aaaattgtgg aaagagcagc tgctaaaagg aaactggaaa agttgatcat ccataaaaat catttcaaag gtggtcagtc tggattaaat ctgtctaaga atttcttaga tcctaaggaa ttaatggaat tattaaaatc tagagattat gaaagggaaa taaaaggatc aagagagaag gtcattagtg ataaagatct agagttgttg ttagatcgaa gtgatcttat tgatcaaatg aatgcttcag gaccaattaa agagaagatg gggatattca agatattaga aaattctgaa gattccagtc ctgaatgttt gttttaa. It is sometimes possible for the material contained within the vial of "HELLS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.