Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HECTD3 cdna clone

HECTD3 cDNA Clone

Synonyms
HECTD3; HECTD3 cDNA Clone; HECTD3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaagggcaccattgtcaagaagctgctactcacagtggataccacagatgacaactttatgccaaagcgggtggtggtctatgggggtgaaggggacaacctgaagaagctgagtgacgtgagcattgacgagaccctcatcggggatgtctgtgtcctggaggacatgaccgtccacctcccgatcatcgagatccgcatcgtggagtgccgagatgatgggattgatgttcgtctccgaggggtcaagatcaagtcatctagacagcgggaactagggttgaatgcagacctgttccagccaactagtctggtgcgatatccacgcctagaaggcaccgaccctgaagtactgtaccgcagagctgtcctcctgcagagattcatcaagatcctcgatagtgtcctgcaccacctggtacctgcctgggaccacacactgggcaccttcagtgagattaagcaagtgaagcagttcctactgctgtcccgccagcggccaggcctggtggctcagtgcctgcgtgactctgagagcagcaagcccagcttcatgccacgcctatacatcaaccgccgtcttgccatggaacaccgtgcctgcccctctcgagaccctgcctgcaagaatgcagtcttcacccaggtatatgaaggcctcaagccctctgacaaatatgaaaagcccctggactacaggtggcccatgcgctatgaccagtggtgggagtgtaaatttattgcagaaggcatcattgaccaagggggtggtttccgggacagcctggcagatatgtcagaagagctgtgccctagctcagcggatacccccgtgcccctgcccttctttgtacgcacagccaaccagggcaatggcactggtgaggctcgggacatgtatgtacccaacccctcctgccgagactttgccaagtatgaatggatcggacagctgatgggggctgcccttcggggtaaggagttcctggtcctggccctgcctggttttgtgtggaagcagctttctggtgaggaggtgagctggagcaaggacttcccagctgtggactctgtgctggtgaagctcctggaagtgatggaaggaatggacaaggagacgtttgagttcaagtttgggaaggaactaacattcaccactgtactgagtgaccaacaggtggtggagctgatccctgggggtgcaggcatcgtcgtgggatatggggaccgttctcgtttcatccaactggtccagaaggcacggctagaggagagcaaggagcaggtggcagctatgcaggcaggtctgctgaaggtggtaccacaggctgtgctggacttgctgacctggcaagagttggagaagaaagtgtgtggggatccagaggtcactgtggatgctctgcgcaagctcacccggtttgaggacttcgagccatctgactcgcgggtgcagtatttctgggaggcactgaacaacttcaccaacgaggaccggagccgcttcctgcgctttgtcacgggccgcagtcgcctgccagcacggatctacatctacccagacaagctgggctacgagaccacagacgcgctgcccgagtcttccacttgctccagcaccctcttcctgccacactatgccagtgccaaggtatgcgaggagaagctccgctatgcggcctacaactgcgtggccatcgacactgacatgagcccttgggaggagtga
Sequence Length
1734
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,688 Da
NCBI Official Full Name
Homo sapiens HECT domain containing 3, mRNA
NCBI Official Synonym Full Names
HECT domain E3 ubiquitin protein ligase 3
NCBI Official Symbol
HECTD3
NCBI Protein Information
E3 ubiquitin-protein ligase HECTD3
UniProt Protein Name
E3 ubiquitin-protein ligase HECTD3
UniProt Gene Name
HECTD3
UniProt Entry Name
HECD3_HUMAN

NCBI Description

The protein encoded by this gene transfers ubiquitin from an E2 ubiquitin-conjugating enzyme to targeted substrates, leading to the degradation of those substrates. The encoded protein has been shown to transfer ubiquitin to TRIOBP to facilitate cell cycle progression, and to STX8. [provided by RefSeq, Dec 2012]

Uniprot Description

HECTD3: E3 ubiquitin ligases accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Mediates ubiquitination of TRIOBP and its subsequent proteasomal degradation, thus faciliting cell cycle progression by regulating the turn-over of TRIOBP. Mediates also ubiquitination of STX8. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.-; EC 6.3.2.19; Ligase; Ubiquitin conjugating system; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 1p34.1

Cellular Component: cytoplasm; nucleus; perinuclear region of cytoplasm

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process

Research Articles on HECTD3

Similar Products

Product Notes

The HECTD3 hectd3 (Catalog #AAA1269244) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaagg gcaccattgt caagaagctg ctactcacag tggataccac agatgacaac tttatgccaa agcgggtggt ggtctatggg ggtgaagggg acaacctgaa gaagctgagt gacgtgagca ttgacgagac cctcatcggg gatgtctgtg tcctggagga catgaccgtc cacctcccga tcatcgagat ccgcatcgtg gagtgccgag atgatgggat tgatgttcgt ctccgagggg tcaagatcaa gtcatctaga cagcgggaac tagggttgaa tgcagacctg ttccagccaa ctagtctggt gcgatatcca cgcctagaag gcaccgaccc tgaagtactg taccgcagag ctgtcctcct gcagagattc atcaagatcc tcgatagtgt cctgcaccac ctggtacctg cctgggacca cacactgggc accttcagtg agattaagca agtgaagcag ttcctactgc tgtcccgcca gcggccaggc ctggtggctc agtgcctgcg tgactctgag agcagcaagc ccagcttcat gccacgccta tacatcaacc gccgtcttgc catggaacac cgtgcctgcc cctctcgaga ccctgcctgc aagaatgcag tcttcaccca ggtatatgaa ggcctcaagc cctctgacaa atatgaaaag cccctggact acaggtggcc catgcgctat gaccagtggt gggagtgtaa atttattgca gaaggcatca ttgaccaagg gggtggtttc cgggacagcc tggcagatat gtcagaagag ctgtgcccta gctcagcgga tacccccgtg cccctgccct tctttgtacg cacagccaac cagggcaatg gcactggtga ggctcgggac atgtatgtac ccaacccctc ctgccgagac tttgccaagt atgaatggat cggacagctg atgggggctg cccttcgggg taaggagttc ctggtcctgg ccctgcctgg ttttgtgtgg aagcagcttt ctggtgagga ggtgagctgg agcaaggact tcccagctgt ggactctgtg ctggtgaagc tcctggaagt gatggaagga atggacaagg agacgtttga gttcaagttt gggaaggaac taacattcac cactgtactg agtgaccaac aggtggtgga gctgatccct gggggtgcag gcatcgtcgt gggatatggg gaccgttctc gtttcatcca actggtccag aaggcacggc tagaggagag caaggagcag gtggcagcta tgcaggcagg tctgctgaag gtggtaccac aggctgtgct ggacttgctg acctggcaag agttggagaa gaaagtgtgt ggggatccag aggtcactgt ggatgctctg cgcaagctca cccggtttga ggacttcgag ccatctgact cgcgggtgca gtatttctgg gaggcactga acaacttcac caacgaggac cggagccgct tcctgcgctt tgtcacgggc cgcagtcgcc tgccagcacg gatctacatc tacccagaca agctgggcta cgagaccaca gacgcgctgc ccgagtcttc cacttgctcc agcaccctct tcctgccaca ctatgccagt gccaaggtat gcgaggagaa gctccgctat gcggcctaca actgcgtggc catcgacact gacatgagcc cttgggagga gtga. It is sometimes possible for the material contained within the vial of "HECTD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.