HDGFRP3 cdna clone
HDGFRP3 cDNA Clone
Gene Names
HDGFRP3; HDGF2; HRP-3; HDGF-2; CGI-142
Synonyms
HDGFRP3; HDGFRP3 cDNA Clone; HDGFRP3 cdna clone
Sequence
atggcgcgtccgcggccccgcgagtacaaagcgggcgacctggtcttcgccaagatgaagggctacccgcactggccggcccggattgatgaactcccagagggcgctgtgaagcctccagcaaacaagtatcctatcttcttttttggcacccatgaaactgcatttctaggtcccaaagacctttttccatataaggagtacaaagacaagtttggaaagtcaaacaaacggaaaggatttaacgaaggattgtgggaaatagaaaataacccaggagtaaagtttactggctaccaggcaattcagcaacagagctcttcagaaactgagggagaaggtggaaatactgcagatgcaagcagtgaggaagaaggtgatagagtagaagaagatggaaaaggcaaaagaaagaatgaaaaagcaggctcaaaacggaaaaagtcatatacttcaaagaaatcctctaaacagtcccggaaatctccaggagatgaagatgacaaagactgcaaagaagaggaaaacaaaagcagctctgagggtggagatgcgggcaacgacacaagaaacacaacttcagacttgcagaaaaccagtgaagggacctaa
Sequence Length
612
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
22,620 Da
NCBI Official Full Name
Homo sapiens hepatoma-derived growth factor, related protein 3, mRNA
NCBI Official Symbol
HDGFRP3
NCBI Official Synonym Symbols
HDGF2; HRP-3; HDGF-2; CGI-142
NCBI Protein Information
hepatoma-derived growth factor-related protein 3
UniProt Protein Name
Hepatoma-derived growth factor-related protein 3
Protein Family
UniProt Gene Name
HDGFRP3
UniProt Synonym Gene Names
HDGF2; HRP-3; HDGF-2
UniProt Entry Name
HDGR3_HUMAN
Uniprot Description
HDGFRP3: Enhances DNA synthesis and may play a role in cell proliferation. Belongs to the HDGF family.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 15q25.2
Cellular Component: cytosol; nucleoplasm; nucleus
Molecular Function: microtubule binding; tubulin binding
Biological Process: microtubule polymerization; negative regulation of microtubule depolymerization; neurite development
Research Articles on HDGFRP3
Similar Products
Product Notes
The HDGFRP3 hdgfrp3 (Catalog #AAA1266585) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcgtc cgcggccccg cgagtacaaa gcgggcgacc tggtcttcgc caagatgaag ggctacccgc actggccggc ccggattgat gaactcccag agggcgctgt gaagcctcca gcaaacaagt atcctatctt cttttttggc acccatgaaa ctgcatttct aggtcccaaa gacctttttc catataagga gtacaaagac aagtttggaa agtcaaacaa acggaaagga tttaacgaag gattgtggga aatagaaaat aacccaggag taaagtttac tggctaccag gcaattcagc aacagagctc ttcagaaact gagggagaag gtggaaatac tgcagatgca agcagtgagg aagaaggtga tagagtagaa gaagatggaa aaggcaaaag aaagaatgaa aaagcaggct caaaacggaa aaagtcatat acttcaaaga aatcctctaa acagtcccgg aaatctccag gagatgaaga tgacaaagac tgcaaagaag aggaaaacaa aagcagctct gagggtggag atgcgggcaa cgacacaaga aacacaactt cagacttgca gaaaaccagt gaagggacct aa. It is sometimes possible for the material contained within the vial of "HDGFRP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
