Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HCST cdna clone

HCST cDNA Clone

Gene Names
HCST; DAP10; KAP10; PIK3AP
Synonyms
HCST; HCST cDNA Clone; HCST cdna clone
Ordering
For Research Use Only!
Sequence
atgatccatctgggtcacatcctcttcctgcttttgctcccagtggctgcagctcagacgactccaggagagagatcatcactccctgccttttaccctggcacttcaggctcttgttccggatgtgggtccctctctctgccgctcctggcaggcctcgtggctgctgatgcggtggcatcgctgctcatcgtgggggcggtgttcctgtgcgcacgcccacgccgcagccccgcccaagaagatggcaaagtctacatcaacatgccaggcaggggctga
Sequence Length
282
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,360 Da
NCBI Official Full Name
Homo sapiens hematopoietic cell signal transducer, mRNA
NCBI Official Synonym Full Names
hematopoietic cell signal transducer
NCBI Official Symbol
HCST
NCBI Official Synonym Symbols
DAP10; KAP10; PIK3AP
NCBI Protein Information
hematopoietic cell signal transducer
UniProt Protein Name
Hematopoietic cell signal transducer
UniProt Gene Name
HCST
UniProt Synonym Gene Names
DAP10; KAP10; PIK3AP
UniProt Entry Name
HCST_HUMAN

NCBI Description

This gene encodes a transmembrane signaling adaptor that contains a YxxM motif in its cytoplasmic domain. The encoded protein may form part of the immune recognition receptor complex with the C-type lectin-like receptor NKG2D. As part of this receptor complex, this protein may activate phosphatidylinositol 3-kinase dependent signaling pathways through its intracytoplasmic YxxM motif. This receptor complex may have a role in cell survival and proliferation by activation of NK and T cell responses. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

HCST: Transmembrane adapter protein which associates with NKG2D to form an activation receptor NKG2D-HCST in lymphoid and myeloid cells; this receptor plays a major role in triggering cytotoxicity against target cells expressing cell surface ligands such as MHC class I chain-related MICA and MICB, and UL16-binding proteins (ULBPs); these ligands are up-regulated by stress conditions and pathological state such as viral infection and tumor transformation. Functions as docking site for PI3-kinase PIK3R1 and GRB2. Interaction of ULBPs with NKG2D-DAP10 triggers calcium mobilization and activation of the PIK3R1, MAP2K/ERK, and JAK2/STAT5 signaling pathways. Both PIK3R1 and GRB2 are required for full NKG2D-HCST-mediated activation and ultimate killing of target cells. In NK cells, NKG2D-HCST signaling directly induces cytotoxicity and enhances cytokine production initiated via DAP12/TYROBP-associated receptors. In T-cells, it provides primarily costimulation for TCR-induced signals. NKG2D-HCST receptor plays a role in immune surveillance against tumors and is required for cytolysis of tumors cells; indeed, melanoma cells that do not express NKG2D ligands escape from immune surveillance mediated by NK cells. Belongs to the DAP10 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 19q13.1

Cellular Component: cell surface; plasma membrane

Molecular Function: phosphoinositide 3-kinase binding; protein binding; receptor binding

Biological Process: positive regulation of phosphoinositide 3-kinase cascade; protein amino acid phosphorylation; regulation of immune response

Research Articles on HCST

Similar Products

Product Notes

The HCST hcst (Catalog #AAA1278545) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatccatc tgggtcacat cctcttcctg cttttgctcc cagtggctgc agctcagacg actccaggag agagatcatc actccctgcc ttttaccctg gcacttcagg ctcttgttcc ggatgtgggt ccctctctct gccgctcctg gcaggcctcg tggctgctga tgcggtggca tcgctgctca tcgtgggggc ggtgttcctg tgcgcacgcc cacgccgcag ccccgcccaa gaagatggca aagtctacat caacatgcca ggcaggggct ga. It is sometimes possible for the material contained within the vial of "HCST, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.