Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HAVCR1 cdna clone

HAVCR1 cDNA Clone

Gene Names
HAVCR1; TIM; KIM1; TIM1; CD365; HAVCR; KIM-1; TIM-1; TIMD1; TIMD-1; HAVCR-1
Synonyms
HAVCR1; HAVCR1 cDNA Clone; HAVCR1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcatcctcaagtggtcatcttaagcctcatcctacatctggcagattctgtagctggttctgtaaaggttggtggagaggcaggtccatctgtcacactaccctgccactacagtggagctgtcacatccatgtgctggaatagaggctcatgttctctattcacatgccaaaatggcattgtctggaccaatggaacccacgtcacctatcggaaggacacacgctataagctattgggggacctttcaagaagggatgtctctttgaccatagaaaatacagctgtgtctgacagtggcgtatattgttgccgtgttgagcaccgtgggtggttcaatgacatgaaaatcaccgtatcattggagattgtgccacccaaggtcacgactactccaattgtcacaactgttccaaccgtcacgactgttcgaacgagcaccactgttccaacgacaacgactgttccaatgacgactgttccaacgacaactgttccaacaacaatgagcattccaacgacaacgactgttctgacgacaatgactgtttcaacgacaacgagcgttccaacgacaacgagcattccaacaacaacaagtgttccagtgacaacaactgtctctacctttgttcctccaatgcctttgcccaggcagaaccatgaaccagtagccacttcaccatcttcacctcagccagcagaaacccaccctacgacactgcagggagcaataaggagagaacccaccagctcaccattgtactcttacacaacagatgggaatgacaccgtgacagagtcttcagatggcctttggaataacaatcaaactcaactgttcctagaacatagtctactgacggccaataccactaaaggaatctatgctggagtctgtatttctgtcttggtgcttcttgctcttttgggtgtcatcattgccaaaaagtatttcttcaaaaaggaggttcaacaactaagtgtttcatttagcagccttcaaattaaagctttgcaaaatgcagttgaaaaggaagtccaagcagaagacaatatctacattgagaatagtctttatgccacggactaa
Sequence Length
1095
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,720 Da
NCBI Official Full Name
Homo sapiens hepatitis A virus cellular receptor 1, mRNA
NCBI Official Synonym Full Names
hepatitis A virus cellular receptor 1
NCBI Official Symbol
HAVCR1
NCBI Official Synonym Symbols
TIM; KIM1; TIM1; CD365; HAVCR; KIM-1; TIM-1; TIMD1; TIMD-1; HAVCR-1
NCBI Protein Information
hepatitis A virus cellular receptor 1
UniProt Protein Name
Hepatitis A virus cellular receptor 1
UniProt Gene Name
HAVCR1
UniProt Synonym Gene Names
KIM1; TIM1; TIMD1; HAVcr-1; KIM-1; TIMD-1; TIM; TIM-1
UniProt Entry Name
HAVR1_HUMAN

NCBI Description

The protein encoded by this gene is a membrane receptor for both human hepatitis A virus (HHAV) and TIMD4. The encoded protein may be involved in the moderation of asthma and allergic diseases. The reference genome represents an allele that retains a MTTVP amino acid segment that confers protection against atopy in HHAV seropositive individuals. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4, 12 and 19. [provided by RefSeq, Apr 2015]

Uniprot Description

TIM-1: May play a role in T-helper cell development and the regulation of asthma and allergic diseases. Receptor for TIMD4. In case of human hepatitis A virus (HHAV) infection, functions as a cell-surface receptor for the virus. May play a role in kidney injury and repair. Belongs to the immunoglobulin superfamily. TIM family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 5q33.2

Molecular Function: viral receptor activity

Disease: Ige Responsiveness, Atopic

Research Articles on HAVCR1

Similar Products

Product Notes

The HAVCR1 havcr1 (Catalog #AAA1265665) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatcctc aagtggtcat cttaagcctc atcctacatc tggcagattc tgtagctggt tctgtaaagg ttggtggaga ggcaggtcca tctgtcacac taccctgcca ctacagtgga gctgtcacat ccatgtgctg gaatagaggc tcatgttctc tattcacatg ccaaaatggc attgtctgga ccaatggaac ccacgtcacc tatcggaagg acacacgcta taagctattg ggggaccttt caagaaggga tgtctctttg accatagaaa atacagctgt gtctgacagt ggcgtatatt gttgccgtgt tgagcaccgt gggtggttca atgacatgaa aatcaccgta tcattggaga ttgtgccacc caaggtcacg actactccaa ttgtcacaac tgttccaacc gtcacgactg ttcgaacgag caccactgtt ccaacgacaa cgactgttcc aatgacgact gttccaacga caactgttcc aacaacaatg agcattccaa cgacaacgac tgttctgacg acaatgactg tttcaacgac aacgagcgtt ccaacgacaa cgagcattcc aacaacaaca agtgttccag tgacaacaac tgtctctacc tttgttcctc caatgccttt gcccaggcag aaccatgaac cagtagccac ttcaccatct tcacctcagc cagcagaaac ccaccctacg acactgcagg gagcaataag gagagaaccc accagctcac cattgtactc ttacacaaca gatgggaatg acaccgtgac agagtcttca gatggccttt ggaataacaa tcaaactcaa ctgttcctag aacatagtct actgacggcc aataccacta aaggaatcta tgctggagtc tgtatttctg tcttggtgct tcttgctctt ttgggtgtca tcattgccaa aaagtatttc ttcaaaaagg aggttcaaca actaagtgtt tcatttagca gccttcaaat taaagctttg caaaatgcag ttgaaaagga agtccaagca gaagacaata tctacattga gaatagtctt tatgccacgg actaa. It is sometimes possible for the material contained within the vial of "HAVCR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.