Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HARS2 cdna clone

HARS2 cDNA Clone

Gene Names
HARS2; HO3; HARSL; HARSR; PRLTS2
Synonyms
HARS2; HARS2 cDNA Clone; HARS2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccctgctcggacttcttcccaggagggcctgggcttcgctgctcagccagctcctgcgaccgccctgcgcttcgtgcaccggggcggtccgttgccaaagccaggttgcagaggcagtgttaacatcccaactgaaagcacatcaagagaaaccaaattttattatcaagaccccaaagggtaccagggatcttagtcctcagcatatggttgtgagggagaaaattcttgatttggttatcagctgctttaaacgtcatggagcaaaggggatggacaccccagcatttgagctgaaggaaaccctgactgagaagtatggagaggactctgggctcatgtatgatctgaaggatcaaggtggagagctgttgtccctccgctatgaccttactgttccctttgctcgttatctggccatgaataaggtgaagaagatgaaacgttatcatgttggaaaggtgtggcggcgagagagcccaaccatagtccaaggccgttatagggagttctgccagtgtgattttgacattgctggtcagtttgaccctatgatccccgatgcagagtgtttgaagatcatgtgtgaaatcctaagtggattgcagttgggagactttctcattaaggtaaatgaccggcggattgtggatgggatgtttgctgtctgtggtgttcctgaaagcaagttccgtgccatctgctcctccatagataaactagacaagatggcttggaaagatgtgagacatgagatggtggtgaagaaaggcctggctcctgaggtggctgatcgaattggggactatgtccagtgtcatggtggggtatccctagtagagcaaatgtttcaggatcccagactatcccagaacaagcaggccctggagggcctgggagacctaaagctgctatttgaatacctgactttatttggaattgctgataagatctcctttgacctcagcctggctcggggcctagactactatacaggagtgatctatgaagcagtgctgctgcagaccccaactcaggctggggaggagcccctgaatgtgggcagtgtggctgctggtgggcgctatgatgggctggtgggcatgtttgaccccaagggccacaaggtgccatgtgtgggactcagcattggggttgagcgaatcttctacattgtggagcagaggatgaagaccaaaggtgagaaggtgcggactacagagactcaagtgtttgtggccacaccacagaagaactttctccaagaacggttgaagcttattgcagagctttgggattctggaatcaaggcagagatgctatacaagaacaaccccaaactattaacccagctgcactattgtgagagcacaggcattccactggtggtcattattggtgagcaagaactgaaagaaggggtcatcaagatccgttcagtggccagcagagaggaggtggccattaaacgggaaaattttgtggctgaaattcagaagcgactgtctgagtcttga
Sequence Length
1521
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,115 Da
NCBI Official Full Name
Homo sapiens histidyl-tRNA synthetase 2, mitochondrial (putative), mRNA
NCBI Official Synonym Full Names
histidyl-tRNA synthetase 2, mitochondrial
NCBI Official Symbol
HARS2
NCBI Official Synonym Symbols
HO3; HARSL; HARSR; PRLTS2
NCBI Protein Information
probable histidine--tRNA ligase, mitochondrial
UniProt Protein Name
Probable histidine--tRNA ligase, mitochondrial
UniProt Gene Name
HARS2
UniProt Synonym Gene Names
HARSL; HARSR; HO3; HisRS
UniProt Entry Name
SYHM_HUMAN

NCBI Description

Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is an enzyme belonging to the class II family of aminoacyl-tRNA synthetases. Functioning in the synthesis of histidyl-transfer RNA, the enzyme plays an accessory role in the regulation of protein biosynthesis. The gene is located in a head-to-head orientation with HARS on chromosome five, where the homologous genes likely share a bidirectional promoter. Mutations in this gene are associated with the pathogenesis of Perrault syndrome, which involves ovarian dysgenesis and sensorineural hearing loss. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]

Uniprot Description

HARS2: Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is an enzyme belonging to the class II family of aminoacyl-tRNA synthetases. Functioning in the synthesis of histidyl-transfer RNA, the enzyme plays an accessory role in the regulation of protein biosynthesis. The gene is located in a head-to-head orientation with HARS on chromosome five, where the homologous genes share a bidirectional promoter. [provided by RefSeq, Jul 2008]

Protein type: Mitochondrial; Translation; Ligase; EC 6.1.1.21

Chromosomal Location of Human Ortholog: 5q31.3

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: histidine-tRNA ligase activity; protein binding; protein homodimerization activity

Biological Process: histidyl-tRNA aminoacylation; mitochondrial translation; tRNA aminoacylation for protein translation

Disease: Perrault Syndrome 2

Research Articles on HARS2

Similar Products

Product Notes

The HARS2 hars2 (Catalog #AAA1271312) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccctgc tcggacttct tcccaggagg gcctgggctt cgctgctcag ccagctcctg cgaccgccct gcgcttcgtg caccggggcg gtccgttgcc aaagccaggt tgcagaggca gtgttaacat cccaactgaa agcacatcaa gagaaaccaa attttattat caagacccca aagggtacca gggatcttag tcctcagcat atggttgtga gggagaaaat tcttgatttg gttatcagct gctttaaacg tcatggagca aaggggatgg acaccccagc atttgagctg aaggaaaccc tgactgagaa gtatggagag gactctgggc tcatgtatga tctgaaggat caaggtggag agctgttgtc cctccgctat gaccttactg ttccctttgc tcgttatctg gccatgaata aggtgaagaa gatgaaacgt tatcatgttg gaaaggtgtg gcggcgagag agcccaacca tagtccaagg ccgttatagg gagttctgcc agtgtgattt tgacattgct ggtcagtttg accctatgat ccccgatgca gagtgtttga agatcatgtg tgaaatccta agtggattgc agttgggaga ctttctcatt aaggtaaatg accggcggat tgtggatggg atgtttgctg tctgtggtgt tcctgaaagc aagttccgtg ccatctgctc ctccatagat aaactagaca agatggcttg gaaagatgtg agacatgaga tggtggtgaa gaaaggcctg gctcctgagg tggctgatcg aattggggac tatgtccagt gtcatggtgg ggtatcccta gtagagcaaa tgtttcagga tcccagacta tcccagaaca agcaggccct ggagggcctg ggagacctaa agctgctatt tgaatacctg actttatttg gaattgctga taagatctcc tttgacctca gcctggctcg gggcctagac tactatacag gagtgatcta tgaagcagtg ctgctgcaga ccccaactca ggctggggag gagcccctga atgtgggcag tgtggctgct ggtgggcgct atgatgggct ggtgggcatg tttgacccca agggccacaa ggtgccatgt gtgggactca gcattggggt tgagcgaatc ttctacattg tggagcagag gatgaagacc aaaggtgaga aggtgcggac tacagagact caagtgtttg tggccacacc acagaagaac tttctccaag aacggttgaa gcttattgca gagctttggg attctggaat caaggcagag atgctataca agaacaaccc caaactatta acccagctgc actattgtga gagcacaggc attccactgg tggtcattat tggtgagcaa gaactgaaag aaggggtcat caagatccgt tcagtggcca gcagagagga ggtggccatt aaacgggaaa attttgtggc tgaaattcag aagcgactgt ctgagtcttg a. It is sometimes possible for the material contained within the vial of "HARS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.