Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HAGH cdna clone

HAGH cDNA Clone

Gene Names
HAGH; GLO2; GLX2; GLXII; HAGH1
Synonyms
HAGH; HAGH cDNA Clone; HAGH cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggtagaggtgctgcctgccctgaccgacaactacatgtacctggtcattgatgatgagaccaaggaggctgccattgtggatccggtgcagccccagaaggtcgtggacgcggcgagaaagcacggggtgaaactgaccacagtgctcaccacccaccaccactgggaccatgctggcgggaatgagaaactggtcaagctggagtcgggactgaaggtgtacgggggtgacgaccgtatcggggccctgactcacaagatcactcacctgtccacactgcaggtggggtctctgaacgtcaagtgcctggcgaccccgtgccacacttcaggacacatttgttacttcgtgagcaagcccggaggctcggagccccctgccgtgttcacaggtgacaccttgtttgtggctggctgcgggaagttctatgaagggactgcggatgagatgtgtaaagctctgctggaggtcttgggccggctccccccggacacaagagtctactgtggccacgagtacaccatcaacaacctcaagtttgcacgccacgtggagcccggcaatgccgccatccgggagaagctggcctgggccaaggagaagtacagcatcggggagcccacagtgccatccaccctggcagaggagtttacctacaaccccttcatgagagtgagggagaagacggtgcagcagcacgcaggtgagacggacccggtgaccaccatgcgggccgtgcgcagggagaaggaccagttcaagatgccccgggactga
Sequence Length
783
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,455 Da
NCBI Official Full Name
Homo sapiens hydroxyacylglutathione hydrolase, mRNA
NCBI Official Synonym Full Names
hydroxyacylglutathione hydrolase
NCBI Official Symbol
HAGH
NCBI Official Synonym Symbols
GLO2; GLX2; GLXII; HAGH1
NCBI Protein Information
hydroxyacylglutathione hydrolase, mitochondrial
UniProt Protein Name
Hydroxyacylglutathione hydrolase, mitochondrial
UniProt Gene Name
HAGH
UniProt Synonym Gene Names
GLO2; HAGH1; Glx II
UniProt Entry Name
GLO2_HUMAN

NCBI Description

The enzyme encoded by this gene is classified as a thiolesterase and is responsible for the hydrolysis of S-lactoyl-glutathione to reduced glutathione and D-lactate. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]

Uniprot Description

HAGH: Thiolesterase that catalyzes the hydrolysis of S-D- lactoyl-glutathione to form glutathione and D-lactic acid. Belongs to the metallo-beta-lactamase superfamily. Glyoxalase II family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Carbohydrate Metabolism - pyruvate; EC 3.1.2.6; Hydrolase; Mitochondrial

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: cytosol

Molecular Function: hydroxyacylglutathione hydrolase activity; protein binding

Biological Process: glutathione biosynthetic process; pyruvate metabolic process

Disease: Hydroxyacyl Glutathione Hydrolase Deficiency

Research Articles on HAGH

Similar Products

Product Notes

The HAGH hagh (Catalog #AAA1270289) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggtag aggtgctgcc tgccctgacc gacaactaca tgtacctggt cattgatgat gagaccaagg aggctgccat tgtggatccg gtgcagcccc agaaggtcgt ggacgcggcg agaaagcacg gggtgaaact gaccacagtg ctcaccaccc accaccactg ggaccatgct ggcgggaatg agaaactggt caagctggag tcgggactga aggtgtacgg gggtgacgac cgtatcgggg ccctgactca caagatcact cacctgtcca cactgcaggt ggggtctctg aacgtcaagt gcctggcgac cccgtgccac acttcaggac acatttgtta cttcgtgagc aagcccggag gctcggagcc ccctgccgtg ttcacaggtg acaccttgtt tgtggctggc tgcgggaagt tctatgaagg gactgcggat gagatgtgta aagctctgct ggaggtcttg ggccggctcc ccccggacac aagagtctac tgtggccacg agtacaccat caacaacctc aagtttgcac gccacgtgga gcccggcaat gccgccatcc gggagaagct ggcctgggcc aaggagaagt acagcatcgg ggagcccaca gtgccatcca ccctggcaga ggagtttacc tacaacccct tcatgagagt gagggagaag acggtgcagc agcacgcagg tgagacggac ccggtgacca ccatgcgggc cgtgcgcagg gagaaggacc agttcaagat gccccgggac tga. It is sometimes possible for the material contained within the vial of "HAGH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.