Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GRIK2 cdna clone

GRIK2 cDNA Clone

Gene Names
GRIK2; EAA4; GLR6; MRT6; GLUK6; GLUR6; GluK2
Synonyms
GRIK2; GRIK2 cDNA Clone; GRIK2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagattattttcccgattctaagtaatccagtcttcaggcgcaccgttaaactcctgctctgtttactgtggattggatattctcaaggaaccacacatgtattaagatttggtggtatttttgaatatgtggaatctggcccaatgggagctgaggaacttgcattcagatttgctgtgaacacaattaacagaaacagaacattgctacccaatactacccttacctatgatacccagaagataaacctttatgatagttttgaagcatccaagaaagcctgtgatcagctgtctcttggggtggctgccatcttcgggccttcacacagctcatcagcaaacgcagtgcagtccatctgcaatgctctgggagttccccacatacagacccgctggaagcaccaggtgtcagacaacaaagattccttctatgtcagtctctacccagacttctcttcactcagccgtgccattttagacctggtgcagtttttcaagtggaaaaccgtcacggttgtgtatgatgacagcactggtctcattcgtttgcaagagctcatcaaagctccatcaaggtataatcttcgactcaaaattcgtcagttacctgctgatacaaaggatgcaaaacccttactaaaagaaatgaaaagaggcaaggagtttcatgtaatctttgattgtagccatgaaatggcagcaggcattttaaaacaggcattagctatgggaatgatgacagaatactatcattatatctttaccactctggacctctttgctcttgatgttgagccctaccgatacagtggtgttaacatgacagggttcagaatattaaatacagaaaatacccaagtctcctccatcattgaaaagtggtcgatggaacgattgcaggcacctccgaaacccgattcaggtttgctggatggatttatgacgatggagtttcactcttgttgcccaggctggagtgcaatggcgcgatctcacctcactgcaacctctgcctcctgggttcaagcgattcttctgcctcagcctcccgagtag
Sequence Length
1062
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
77,112 Da
NCBI Official Full Name
Homo sapiens glutamate receptor, ionotropic, kainate 2, mRNA
NCBI Official Synonym Full Names
glutamate ionotropic receptor kainate type subunit 2
NCBI Official Symbol
GRIK2
NCBI Official Synonym Symbols
EAA4; GLR6; MRT6; GLUK6; GLUR6; GluK2
NCBI Protein Information
glutamate receptor ionotropic, kainate 2
UniProt Protein Name
Glutamate receptor ionotropic, kainate 2
UniProt Gene Name
GRIK2
UniProt Synonym Gene Names
GLUR6; GluK2; EAA4; GluR-6; GluR6
UniProt Entry Name
GRIK2_HUMAN

NCBI Description

Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. Mutations in this gene have been associated with autosomal recessive mental retardation. [provided by RefSeq, Jul 2008]

Uniprot Description

GluR6: Ionotropic glutamate receptor. L-glutamate acts as an excitatory neurotransmitter at many synapses in the central nervous system. Binding of the excitatory neurotransmitter L- glutamate induces a conformation change, leading to the opening of the cation channel, and thereby converts the chemical signal to an electrical impulse. The receptor then desensitizes rapidly and enters a transient inactive state, characterized by the presence of bound agonist. May be involved in the transmission of light information from the retina to the hypothalamus. Modulates cell surface expression of NETO2. Defects in GRIK2 are the cause of mental retardation autosomal recessive type 6 (MRT6). It is characterized by significantly sub-average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. In contrast to syndromic or specific mental retardation which also present with associated physical, neurological and/or psychiatric manifestations, intellectual deficiency is the only primary symptom of non-syndromic mental retardation. MRT6 patients display mild to severe mental retardation and psychomotor development delay in early childhood. Patients do not have neurologic problems, congenital malformations, or facial dysmorphism. Body height, weight, and head circumference are normal. Belongs to the glutamate-gated ion channel (TC 1.A.10.1) family. GRIK2 subfamily. 7 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Channel, calcium; Channel, ligand-gated

Chromosomal Location of Human Ortholog: 6q16.3

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: kainate selective glutamate receptor activity; ligand-gated ion channel activity

Biological Process: glutamate signaling pathway; positive regulation of synaptic transmission; regulation of short-term neuronal synaptic plasticity; regulation of synaptic transmission; synaptic transmission

Disease: Mental Retardation, Autosomal Recessive 6

Research Articles on GRIK2

Similar Products

Product Notes

The GRIK2 grik2 (Catalog #AAA1275934) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagatta ttttcccgat tctaagtaat ccagtcttca ggcgcaccgt taaactcctg ctctgtttac tgtggattgg atattctcaa ggaaccacac atgtattaag atttggtggt atttttgaat atgtggaatc tggcccaatg ggagctgagg aacttgcatt cagatttgct gtgaacacaa ttaacagaaa cagaacattg ctacccaata ctacccttac ctatgatacc cagaagataa acctttatga tagttttgaa gcatccaaga aagcctgtga tcagctgtct cttggggtgg ctgccatctt cgggccttca cacagctcat cagcaaacgc agtgcagtcc atctgcaatg ctctgggagt tccccacata cagacccgct ggaagcacca ggtgtcagac aacaaagatt ccttctatgt cagtctctac ccagacttct cttcactcag ccgtgccatt ttagacctgg tgcagttttt caagtggaaa accgtcacgg ttgtgtatga tgacagcact ggtctcattc gtttgcaaga gctcatcaaa gctccatcaa ggtataatct tcgactcaaa attcgtcagt tacctgctga tacaaaggat gcaaaaccct tactaaaaga aatgaaaaga ggcaaggagt ttcatgtaat ctttgattgt agccatgaaa tggcagcagg cattttaaaa caggcattag ctatgggaat gatgacagaa tactatcatt atatctttac cactctggac ctctttgctc ttgatgttga gccctaccga tacagtggtg ttaacatgac agggttcaga atattaaata cagaaaatac ccaagtctcc tccatcattg aaaagtggtc gatggaacga ttgcaggcac ctccgaaacc cgattcaggt ttgctggatg gatttatgac gatggagttt cactcttgtt gcccaggctg gagtgcaatg gcgcgatctc acctcactgc aacctctgcc tcctgggttc aagcgattct tctgcctcag cctcccgagt ag. It is sometimes possible for the material contained within the vial of "GRIK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.