Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPR61 cdna clone

GPR61 cDNA Clone

Gene Names
GPR61; BALGR; GPCR3
Synonyms
GPR61; GPR61 cDNA Clone; GPR61 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtcctcacccatcccccagtcatcagggaactcttccactttggggagggtccctcaaaccccaggtccctctactgccagtggggtcccggaggtggggctacgggatgttgcttcggaatctgtggccctcttcttcatgctcctgctggacttgactgctgtggctggcaatgccgctgtgatggccgtgatcgccaagacgcctgccctccgaaaatttgtcttcgtcttccacctctgcctggtggacctgctggctgccctgaccctcatgcccctggccatgctctccagctctgccctctttgaccacgccctctttggggaggtggcctgccgcctctacttgtttctgagcgtgtgctttgtcagcctggccatcctctcggtgtcagccatcaatgtggagcgctactattacgtagtccaccccatgcgctacgaggtgcgcatgacgctggggctggtggcctctgtgctggtgggtgtgtgggtgaaggccttggccatggcttctgtgccagtgttgggaagggtctcctgggaggaaggagctcccagtgtccccccaggctgttcactccagtggagccacagtgcctactgccagctttttgtggtggtctttgctgtcctttactttctgttgcccctgctcctcatacttgtggtctactgcagcatgttccgagtggcccgcgtggctgccatgcagcacgggccgctgcccacgtggatggagacaccccggcaacgctccgaatctctcagcagccgctccacgatggtcaccagctcgggggccccccagaccaccccacaccggacgtttgggggagggaaagcagcagtggttctcctggctgtggggggacagttcctgctctgttggttgccctacttctctttccacctctatgttgccctgagtgctcagcccatttcaactgggcaggtggagagtgtggtcacctggattggctacttttgcttcacttccaaccctttcttctatggatgtctcaaccggcagatccggggggagctcagcaagcagtttgtctgcttcttcaagccagctccagagaaggagctgaggctgcctagccgggagggctccattgaggagaacttcctgcagttccttcaggggactggctgtccttctgagtcctgggtttcccgacccctacccagccccaagcaggagccacctgctgttgactttcgaatcccaggccagatagctgaggagacctctgagttcctggagcagcaactcaccagcgacatcatcatgtcagacagctacctccgtcctgccgcctcaccccggctggagtcatga
Sequence Length
1356
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,292 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 61, mRNA
NCBI Official Synonym Full Names
G protein-coupled receptor 61
NCBI Official Symbol
GPR61
NCBI Official Synonym Symbols
BALGR; GPCR3
NCBI Protein Information
probable G-protein coupled receptor 61
UniProt Protein Name
Probable G-protein coupled receptor 61
UniProt Gene Name
GPR61
UniProt Synonym Gene Names
BALGR
UniProt Entry Name
GPR61_HUMAN

NCBI Description

This gene belongs to the G-protein coupled receptor 1 family. G protein-coupled receptors contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. The protein encoded by this gene is most closely related to biogenic amine receptors. [provided by RefSeq, Jul 2008]

Uniprot Description

GPR61: Orphan receptor. Belongs to the G-protein coupled receptor 1 family.

Protein type: Receptor, GPCR; Membrane protein, integral; Membrane protein, multi-pass; GPCR, family 1

Chromosomal Location of Human Ortholog: 1p13.3

Cellular Component: receptor complex

Research Articles on GPR61

Similar Products

Product Notes

The GPR61 gpr61 (Catalog #AAA1278822) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtcct cacccatccc ccagtcatca gggaactctt ccactttggg gagggtccct caaaccccag gtccctctac tgccagtggg gtcccggagg tggggctacg ggatgttgct tcggaatctg tggccctctt cttcatgctc ctgctggact tgactgctgt ggctggcaat gccgctgtga tggccgtgat cgccaagacg cctgccctcc gaaaatttgt cttcgtcttc cacctctgcc tggtggacct gctggctgcc ctgaccctca tgcccctggc catgctctcc agctctgccc tctttgacca cgccctcttt ggggaggtgg cctgccgcct ctacttgttt ctgagcgtgt gctttgtcag cctggccatc ctctcggtgt cagccatcaa tgtggagcgc tactattacg tagtccaccc catgcgctac gaggtgcgca tgacgctggg gctggtggcc tctgtgctgg tgggtgtgtg ggtgaaggcc ttggccatgg cttctgtgcc agtgttggga agggtctcct gggaggaagg agctcccagt gtccccccag gctgttcact ccagtggagc cacagtgcct actgccagct ttttgtggtg gtctttgctg tcctttactt tctgttgccc ctgctcctca tacttgtggt ctactgcagc atgttccgag tggcccgcgt ggctgccatg cagcacgggc cgctgcccac gtggatggag acaccccggc aacgctccga atctctcagc agccgctcca cgatggtcac cagctcgggg gccccccaga ccaccccaca ccggacgttt gggggaggga aagcagcagt ggttctcctg gctgtggggg gacagttcct gctctgttgg ttgccctact tctctttcca cctctatgtt gccctgagtg ctcagcccat ttcaactggg caggtggaga gtgtggtcac ctggattggc tacttttgct tcacttccaa ccctttcttc tatggatgtc tcaaccggca gatccggggg gagctcagca agcagtttgt ctgcttcttc aagccagctc cagagaagga gctgaggctg cctagccggg agggctccat tgaggagaac ttcctgcagt tccttcaggg gactggctgt ccttctgagt cctgggtttc ccgaccccta cccagcccca agcaggagcc acctgctgtt gactttcgaa tcccaggcca gatagctgag gagacctctg agttcctgga gcagcaactc accagcgaca tcatcatgtc agacagctac ctccgtcctg ccgcctcacc ccggctggag tcatga. It is sometimes possible for the material contained within the vial of "GPR61, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.