Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPD1L cdna clone

GPD1L cDNA Clone

Gene Names
GPD1L; GPD1-L
Synonyms
GPD1L; GPD1L cDNA Clone; GPD1L cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcggcgcccctgaaagtgtgcatcgtgggctcggggaactggggttcagctgttgcaaaaataattggtaataatgtcaagaaacttcagaaatttgcctccacagtcaagatgtgggtctttgaagaaacagtgaatggcagaaaactgacagacatcataaataatgaccatgaaaatgtaaaatatcttcctggacacaagctgccagaaaatgtggttgccatgtcaaatcttagcgaggctgtgcaggatgcagacctgctggtgtttgtcattccccaccagttcattcacagaatctgtgatgagatcactgggagagtgcccaagaaagcgctgggaatcaccctcatcaagggcatagacgagggccccgaggggctgaagctcatttctgacatcatccgtgagaagatgggtattgacatcagtgtgctgatgggagccaacattgccaatgaggtggctgcagagaagttctgtgagaccaccatcggcagcaaagtaatggagaacggccttctcttcaaagaacttctgcagactccaaattttcgaattaccgtggttgatgatgcagacactgttgaactatgtggtgcgcttaagaacatcgtagctgtgggagctgggttctgcgacggcctccgctgtggagacaacaccaaagcggccgtcatccgcctgggactcatggaaatgattgcttttgccaggatcttctgcaaaggccaagtgtctacagccaccttcctagagagctgcggggtggccgacctgatcaccacctgttacggagggcggaaccgcagggtggccgaggccttcgccagaactgggaagaccattgaagagttggagaaggagatgctgaatgggcaaaagctccaaggaccgcagacttctgctgaagtgtaccgcatcctcaaacagaagggactactggacaagtttccattgtttactgcagtgtatcagatctgctacgaaagcagaccagttcaagagatgttgtcttgtcttcagagccatccagagcatacataa
Sequence Length
1056
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,419 Da
NCBI Official Full Name
Homo sapiens glycerol-3-phosphate dehydrogenase 1-like, mRNA
NCBI Official Synonym Full Names
glycerol-3-phosphate dehydrogenase 1-like
NCBI Official Symbol
GPD1L
NCBI Official Synonym Symbols
GPD1-L
NCBI Protein Information
glycerol-3-phosphate dehydrogenase 1-like protein
UniProt Protein Name
Glycerol-3-phosphate dehydrogenase 1-like protein
UniProt Gene Name
GPD1L
UniProt Synonym Gene Names
KIAA0089; GPD1-L
UniProt Entry Name
GPD1L_HUMAN

NCBI Description

The protein encoded by this gene catalyzes the conversion of sn-glycerol 3-phosphate to glycerone phosphate. The encoded protein is found in the cytoplasm, associated with the plasma membrane, where it binds the sodium channel, voltage-gated, type V, alpha subunit (SCN5A). Defects in this gene are a cause of Brugada syndrome type 2 (BRS2) as well as sudden infant death syndrome (SIDS). [provided by RefSeq, Jul 2010]

Uniprot Description

GPD1L: Plays a role in regulating cardiac sodium current; decreased enzymatic activity with resulting increased levels of glycerol 3-phosphate activating the DPD1L-dependent SCN5A phosphorylation pathway, may ultimately lead to decreased sodium current; cardiac sodium current may also be reduced due to alterations of NAD(H) balance induced by DPD1L. Defects in GPD1L are the cause of Brugada syndrome type 2 (BRGDA2). An autosomal dominant tachyarrhythmia characterized by right bundle branch block and ST segment elevation on an electrocardiogram (ECG). It can cause the ventricles to beat so fast that the blood is prevented from circulating efficiently in the body. When this situation occurs (called ventricular fibrillation), the individual will faint and may die in a few minutes if the heart is not reset. Defects in GPD1L are a cause of sudden infant death syndrome (SIDS). SIDS is the sudden death of an infant younger than 1 year that remains unexplained after a thorough case investigation, including performance of a complete autopsy, examination of the death scene, and review of clinical history. Pathophysiologic mechanisms for SIDS may include respiratory dysfunction, cardiac dysrhythmias, cardiorespiratory instability, and inborn errors of metabolism, but definitive pathogenic mechanisms precipitating an infant sudden death remain elusive. Belongs to the NAD-dependent glycerol-3-phosphate dehydrogenase family.

Protein type: Lipid Metabolism - glycerophospholipid; Oxidoreductase; EC 1.1.1.8

Chromosomal Location of Human Ortholog: 3p22.3

Cellular Component: cytosol; plasma membrane

Molecular Function: glycerol-3-phosphate dehydrogenase (NAD+) activity; sodium channel regulator activity

Biological Process: NAD metabolic process; negative regulation of peptidyl-serine phosphorylation; phosphatidic acid biosynthetic process; regulation of heart rate; triacylglycerol biosynthetic process

Disease: Brugada Syndrome 2

Research Articles on GPD1L

Similar Products

Product Notes

The GPD1L gpd1l (Catalog #AAA1274283) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcgg cgcccctgaa agtgtgcatc gtgggctcgg ggaactgggg ttcagctgtt gcaaaaataa ttggtaataa tgtcaagaaa cttcagaaat ttgcctccac agtcaagatg tgggtctttg aagaaacagt gaatggcaga aaactgacag acatcataaa taatgaccat gaaaatgtaa aatatcttcc tggacacaag ctgccagaaa atgtggttgc catgtcaaat cttagcgagg ctgtgcagga tgcagacctg ctggtgtttg tcattcccca ccagttcatt cacagaatct gtgatgagat cactgggaga gtgcccaaga aagcgctggg aatcaccctc atcaagggca tagacgaggg ccccgagggg ctgaagctca tttctgacat catccgtgag aagatgggta ttgacatcag tgtgctgatg ggagccaaca ttgccaatga ggtggctgca gagaagttct gtgagaccac catcggcagc aaagtaatgg agaacggcct tctcttcaaa gaacttctgc agactccaaa ttttcgaatt accgtggttg atgatgcaga cactgttgaa ctatgtggtg cgcttaagaa catcgtagct gtgggagctg ggttctgcga cggcctccgc tgtggagaca acaccaaagc ggccgtcatc cgcctgggac tcatggaaat gattgctttt gccaggatct tctgcaaagg ccaagtgtct acagccacct tcctagagag ctgcggggtg gccgacctga tcaccacctg ttacggaggg cggaaccgca gggtggccga ggccttcgcc agaactggga agaccattga agagttggag aaggagatgc tgaatgggca aaagctccaa ggaccgcaga cttctgctga agtgtaccgc atcctcaaac agaagggact actggacaag tttccattgt ttactgcagt gtatcagatc tgctacgaaa gcagaccagt tcaagagatg ttgtcttgtc ttcagagcca tccagagcat acataa. It is sometimes possible for the material contained within the vial of "GPD1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.