Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPD1 cdna clone

GPD1 cDNA Clone

Gene Names
GPD1; GPD-C; HTGTI; GPDH-C
Synonyms
GPD1; GPD1 cDNA Clone; GPD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctagcaagaaagtctgcattgtaggctccgggaactggggctcagccatcgccaagatcgtgggtggcaatgcagcccagctggcacagtttgacccacgggtgaccatgtgggtatttgaggaagacattggaggcaaaaagctgactgagatcatcaacacgcagcatgagaatgtcaaatacctgccagggcacaagttgcccccaaatgtggtggctgtcccagatgtggtccaggctgcagaggatgctgacatcctgatctttgtggtgccccatcagttcatcggcaagatctgtgaccagctcaagggccatctgaaggcaaacgccactggcatatctcttattaagggggtagacgagggccccaatgggctgaagctcatctcggaagtgattggggagcgcctcggcatccccatgagtgtgctgatgggggccaacattgccagcgaggtggctgatgagaagttctgtgagacaaccattggctgcaaggacccggcccagggacaactcctgaaagagctgatgcagacaccaaacttccgtatcacagtggtgcaagaggtggacacagtagagatctgtggagccttaaagaatgtagtggccgtgggggctggcttctgtgatggcctgggctttggcgacaacaccaaggcggcagtgatccggctgggactcatggagatgatagccttcgccaagctcttctgcagtggccctgtgtcctctgccaccttcttggagagctgtggtgttgctgacctgatcactacctgctatggagggcggaaccggaaagtggctgaggcctttgcgcgtacaggaaagtccattgagcagctggagaaagagttgctgaatgggcagaaactgcaggggcccgagacagcccgggagctatacagcatcctccagcacaagggcctggtagacaagtttcccttgttcatggctgtgtacaaggtgtgctacgagggccagccagtgggtgaattcatccactgcctgcagaatcatccagaacatatgtga
Sequence Length
1050
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,140 Da
NCBI Official Full Name
Homo sapiens glycerol-3-phosphate dehydrogenase 1 (soluble), mRNA
NCBI Official Synonym Full Names
glycerol-3-phosphate dehydrogenase 1
NCBI Official Symbol
GPD1
NCBI Official Synonym Symbols
GPD-C; HTGTI; GPDH-C
NCBI Protein Information
glycerol-3-phosphate dehydrogenase [NAD(+)], cytoplasmic
UniProt Protein Name
Glycerol-3-phosphate dehydrogenase [NAD(+)], cytoplasmic
UniProt Gene Name
GPD1
UniProt Synonym Gene Names
GPD-C; GPDH-C
UniProt Entry Name
GPDA_HUMAN

NCBI Description

This gene encodes a member of the NAD-dependent glycerol-3-phosphate dehydrogenase family. The encoded protein plays a critical role in carbohydrate and lipid metabolism by catalyzing the reversible conversion of dihydroxyacetone phosphate (DHAP) and reduced nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. The encoded cytosolic protein and mitochondrial glycerol-3-phosphate dehydrogenase also form a glycerol phosphate shuttle that facilitates the transfer of reducing equivalents from the cytosol to mitochondria. Mutations in this gene are a cause of transient infantile hypertriglyceridemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]

Uniprot Description

GPD1: Defects in GPD1 are a cause of hypertriglyceridemia, transient infantile (HTGTI). An autosomal recessive disorder characterized by onset of moderate to severe transient hypertriglyceridemia in infancy that normalizes with age. The hypertriglyceridemia is associated with hepatomegaly, moderately elevated transaminases, persistent fatty liver, and the development of hepatic fibrosis. Belongs to the NAD-dependent glycerol-3-phosphate dehydrogenase family.

Protein type: Oxidoreductase; Lipid Metabolism - glycerophospholipid; EC 1.1.1.8

Chromosomal Location of Human Ortholog: 12q13.12

Cellular Component: cytosol

Molecular Function: glycerol-3-phosphate dehydrogenase (NAD+) activity

Biological Process: phosphatidic acid biosynthetic process; triacylglycerol biosynthetic process

Disease: Hypertriglyceridemia, Transient Infantile

Research Articles on GPD1

Similar Products

Product Notes

The GPD1 gpd1 (Catalog #AAA1278031) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctagca agaaagtctg cattgtaggc tccgggaact ggggctcagc catcgccaag atcgtgggtg gcaatgcagc ccagctggca cagtttgacc cacgggtgac catgtgggta tttgaggaag acattggagg caaaaagctg actgagatca tcaacacgca gcatgagaat gtcaaatacc tgccagggca caagttgccc ccaaatgtgg tggctgtccc agatgtggtc caggctgcag aggatgctga catcctgatc tttgtggtgc cccatcagtt catcggcaag atctgtgacc agctcaaggg ccatctgaag gcaaacgcca ctggcatatc tcttattaag ggggtagacg agggccccaa tgggctgaag ctcatctcgg aagtgattgg ggagcgcctc ggcatcccca tgagtgtgct gatgggggcc aacattgcca gcgaggtggc tgatgagaag ttctgtgaga caaccattgg ctgcaaggac ccggcccagg gacaactcct gaaagagctg atgcagacac caaacttccg tatcacagtg gtgcaagagg tggacacagt agagatctgt ggagccttaa agaatgtagt ggccgtgggg gctggcttct gtgatggcct gggctttggc gacaacacca aggcggcagt gatccggctg ggactcatgg agatgatagc cttcgccaag ctcttctgca gtggccctgt gtcctctgcc accttcttgg agagctgtgg tgttgctgac ctgatcacta cctgctatgg agggcggaac cggaaagtgg ctgaggcctt tgcgcgtaca ggaaagtcca ttgagcagct ggagaaagag ttgctgaatg ggcagaaact gcaggggccc gagacagccc gggagctata cagcatcctc cagcacaagg gcctggtaga caagtttccc ttgttcatgg ctgtgtacaa ggtgtgctac gagggccagc cagtgggtga attcatccac tgcctgcaga atcatccaga acatatgtga. It is sometimes possible for the material contained within the vial of "GPD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.