GNL1 cdna clone
GNL1 cDNA Clone
Gene Names
GNL1; HSR1
Synonyms
GNL1; GNL1 cDNA Clone; GNL1 cdna clone
Sequence
atgccgaggaagaagccattcagcgtgaagcagaagaagaagcagttgcaggacaaacgggagcggaagagagggcttcaagatgggctgcgctccagttccaacagccgcagcgggagccgggagcggcgagaggaacagaccgacacctcggacggggagtctgtgacccatcatatccgcaggcttaaccagcagccttctcaggggctgggtccacgaggctacgacccaaatcgataccgactgcattttgagagagacagcagggaggaggtagagaggagaaagagagcagcccgggagcaagttctacagccggtcagtgctgagttgttggagctggacatccgggaggtgtatcagcctggctcagttctggactttcctcgacgtcctccttggagctatgagatgtccaaggagcaactaatgagccaagaggaacggagcttccaagactatcttgggaagattcatggggcttactcctctgagaaactcagctactttgagcacaatctggagacatggaggcagctgtggcgggtgttagagatgtctgacatcgtcctgcttatcactgatatccgacatccagttgtgaatttcccgccagcactttatgagtatgtgactggagaacttggactggccctggtgctggttttgaacaaggtggatctggccccgccagctcttgtggttgcctggaagcattatttccatcaacactatccccagctccacgtcgtccttttcacctcttttcctcgggacccccgcaccccacaggatcctagtagtgtcttgaagaagagtcggaggcgggggagaggatggactcgggccctggggccagagcagttgctgagagcctgtgaagccatcactgtggggaaagtggacttgagcagctggcgggagaagattgctcgggatgtggctggggccacctggggtaatggctctggggaggaggaggaagaggaggatggcccagcagtcctggtggagcagcagactgattcagcaatggagccaactggcccaacccaagagcgctacaaggatggggtggtgaccatcggctgtgtgggtttccctaatgtgggaaagtcctcgctgatcaatgggctggtggggcggaaagtcgtgagtgtctccagaaccccgggccatacccgatactttcagacctactttcttaccccctctgtgaagctctgtgactgcccaggcctcatcttcccatctcttctgcctaggcagttgcaggttctggcagggatctaccctatcgcccagatccaggagccctacactgctgtgggctacctggcctcccgaattcccgtgcaggccctgctccacctgcgccacccagaggctgaggacccctcagcggaacacccctggtgtgcctgggacatctgtgaagcctgggcagagaaacgtggttacaagacagccaaggcggctcggaatgatgtgtacagagcagccaacagtctcttgcggctggcagtggacggccgcctcagcctgtgttttcatcccccaggctacagtgaacagaaaggcacctgggagtcccatccagagaccacggagctggtggttttgcagggcagggtggggccagcaggtgacgaggaggaggaggaagaggaagagctgagcagctcctgtgaggaggagggagaggaggaccgggatgcggatgaggagggagaaggggatgaggagaccccaacctcggctccagggtccagcctggctggccgaaacccttatgccctgctgggtgaggatgagtgctga
Sequence Length
1824
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
47,306 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein-like 1, mRNA
NCBI Official Synonym Full Names
G protein nucleolar 1 (putative)
NCBI Official Symbol
GNL1
NCBI Official Synonym Symbols
HSR1
NCBI Protein Information
guanine nucleotide-binding protein-like 1
UniProt Protein Name
Guanine nucleotide-binding protein-like 1
Protein Family
UniProt Gene Name
GNL1
UniProt Synonym Gene Names
HSR1
UniProt Entry Name
GNL1_HUMAN
NCBI Description
The GNL1 gene, identified in the human major histocompatibility complex class I region, shows a high degree of similarity with its mouse counterpart. The GNL1 gene is located less than 2 kb centromeric to HLA-E, in the same transcriptional orientation. GNL1 is telomeric to HLA-B and HLA-C. [provided by RefSeq, Jul 2008]
Uniprot Description
GNL1: a putative GTP-binding protein.
Protein type: Hydrolase
Chromosomal Location of Human Ortholog: 6p21.3
Cellular Component: nucleus
Molecular Function: GTPase activity
Biological Process: response to DNA damage stimulus; ribosome biogenesis and assembly
Research Articles on GNL1
Similar Products
Product Notes
The GNL1 gnl1 (Catalog #AAA1275467) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgagga agaagccatt cagcgtgaag cagaagaaga agcagttgca ggacaaacgg gagcggaaga gagggcttca agatgggctg cgctccagtt ccaacagccg cagcgggagc cgggagcggc gagaggaaca gaccgacacc tcggacgggg agtctgtgac ccatcatatc cgcaggctta accagcagcc ttctcagggg ctgggtccac gaggctacga cccaaatcga taccgactgc attttgagag agacagcagg gaggaggtag agaggagaaa gagagcagcc cgggagcaag ttctacagcc ggtcagtgct gagttgttgg agctggacat ccgggaggtg tatcagcctg gctcagttct ggactttcct cgacgtcctc cttggagcta tgagatgtcc aaggagcaac taatgagcca agaggaacgg agcttccaag actatcttgg gaagattcat ggggcttact cctctgagaa actcagctac tttgagcaca atctggagac atggaggcag ctgtggcggg tgttagagat gtctgacatc gtcctgctta tcactgatat ccgacatcca gttgtgaatt tcccgccagc actttatgag tatgtgactg gagaacttgg actggccctg gtgctggttt tgaacaaggt ggatctggcc ccgccagctc ttgtggttgc ctggaagcat tatttccatc aacactatcc ccagctccac gtcgtccttt tcacctcttt tcctcgggac ccccgcaccc cacaggatcc tagtagtgtc ttgaagaaga gtcggaggcg ggggagagga tggactcggg ccctggggcc agagcagttg ctgagagcct gtgaagccat cactgtgggg aaagtggact tgagcagctg gcgggagaag attgctcggg atgtggctgg ggccacctgg ggtaatggct ctggggagga ggaggaagag gaggatggcc cagcagtcct ggtggagcag cagactgatt cagcaatgga gccaactggc ccaacccaag agcgctacaa ggatggggtg gtgaccatcg gctgtgtggg tttccctaat gtgggaaagt cctcgctgat caatgggctg gtggggcgga aagtcgtgag tgtctccaga accccgggcc atacccgata ctttcagacc tactttctta ccccctctgt gaagctctgt gactgcccag gcctcatctt cccatctctt ctgcctaggc agttgcaggt tctggcaggg atctacccta tcgcccagat ccaggagccc tacactgctg tgggctacct ggcctcccga attcccgtgc aggccctgct ccacctgcgc cacccagagg ctgaggaccc ctcagcggaa cacccctggt gtgcctggga catctgtgaa gcctgggcag agaaacgtgg ttacaagaca gccaaggcgg ctcggaatga tgtgtacaga gcagccaaca gtctcttgcg gctggcagtg gacggccgcc tcagcctgtg ttttcatccc ccaggctaca gtgaacagaa aggcacctgg gagtcccatc cagagaccac ggagctggtg gttttgcagg gcagggtggg gccagcaggt gacgaggagg aggaggaaga ggaagagctg agcagctcct gtgaggagga gggagaggag gaccgggatg cggatgagga gggagaaggg gatgaggaga ccccaacctc ggctccaggg tccagcctgg ctggccgaaa cccttatgcc ctgctgggtg aggatgagtg ctga. It is sometimes possible for the material contained within the vial of "GNL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
