Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNB5 cdna clone

GNB5 cDNA Clone

Gene Names
GNB5; GB5
Synonyms
GNB5; GNB5 cDNA Clone; GNB5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaaccgaggggctgcacgagaacgagacgctggcgtcgctgaagagcgaggccgagagcctcaagggcaagctggaggaggagcgagccaagctgcacgatgtggagctgcaccaggtggcggagcgggtggaggccctggggcagtttgtcatgaagaccagaaggaccctcaaaggccacgggaacaaagtcctgtgcatggactggtgcaaagataagaggaggatcgtgagctcgtcacaggatgggaaggtgatcgtgtgggattccttcaccacaaacaaggagcacgcggtcaccatgccctgcacgtgggtgatggcatgtgcttatgccccatcgggatgtgccattgcttgtggtggtttggataataagtgttctgtgtaccccttgacgtttgacaaaaatgaaaacatggctgccaaaaagaagtctgttgctatgcacaccaactacctgtcggcctgcagcttcaccaactctgacatgcagatcctgacagcgagcggcgatggcacatgtgccctgtgggacgtggagagcgggcagctgctgcagagcttccacggacatggggctgacgtcctctgcttggacctggccccctcagaaactggaaacaccttcgtgtctgggggatgtgacaagaaagccatggtgtgggacatgcgctccggccagtgcgtgcaggcctttgaaacacatgaatctgacatcaacagtgtccggtactaccccagtggagatgcctttgcttcagggtcagatgacgctacgtgtcgcctctatgacctgcgggcagatagggaggttgccatctattccaaagaaagcatcatatttggagcatccagcgtggacttctccctcagtggtcgcctgctgtttgctggatacaatgattacactatcaacgtctgggatgttctcaaagggtcccgggtctccatcctgtttggacatgaaaaccgcgttagcactctacgagtttcccccgatgggactgctttctgctctggatcatgggatcataccctcagagtctgggcctaa
Sequence Length
1062
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,247 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), beta 5, mRNA
NCBI Official Synonym Full Names
G protein subunit beta 5
NCBI Official Symbol
GNB5
NCBI Official Synonym Symbols
GB5
NCBI Protein Information
guanine nucleotide-binding protein subunit beta-5
UniProt Protein Name
Guanine nucleotide-binding protein subunit beta-5
UniProt Gene Name
GNB5
UniProt Entry Name
GBB5_HUMAN

NCBI Description

Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternatively spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Jul 2008]

Uniprot Description

G-beta 5: Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein- effector interaction. Belongs to the WD repeat G protein beta family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein, heterotrimeric beta

Chromosomal Location of Human Ortholog: 15q21.2

Cellular Component: cytosol

Molecular Function: chaperone binding; G-protein gamma-subunit binding; GTPase activator activity; protein binding

Biological Process: positive regulation of GTPase activity; protein folding

Research Articles on GNB5

Similar Products

Product Notes

The GNB5 gnb5 (Catalog #AAA1272038) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaaccg aggggctgca cgagaacgag acgctggcgt cgctgaagag cgaggccgag agcctcaagg gcaagctgga ggaggagcga gccaagctgc acgatgtgga gctgcaccag gtggcggagc gggtggaggc cctggggcag tttgtcatga agaccagaag gaccctcaaa ggccacggga acaaagtcct gtgcatggac tggtgcaaag ataagaggag gatcgtgagc tcgtcacagg atgggaaggt gatcgtgtgg gattccttca ccacaaacaa ggagcacgcg gtcaccatgc cctgcacgtg ggtgatggca tgtgcttatg ccccatcggg atgtgccatt gcttgtggtg gtttggataa taagtgttct gtgtacccct tgacgtttga caaaaatgaa aacatggctg ccaaaaagaa gtctgttgct atgcacacca actacctgtc ggcctgcagc ttcaccaact ctgacatgca gatcctgaca gcgagcggcg atggcacatg tgccctgtgg gacgtggaga gcgggcagct gctgcagagc ttccacggac atggggctga cgtcctctgc ttggacctgg ccccctcaga aactggaaac accttcgtgt ctgggggatg tgacaagaaa gccatggtgt gggacatgcg ctccggccag tgcgtgcagg cctttgaaac acatgaatct gacatcaaca gtgtccggta ctaccccagt ggagatgcct ttgcttcagg gtcagatgac gctacgtgtc gcctctatga cctgcgggca gatagggagg ttgccatcta ttccaaagaa agcatcatat ttggagcatc cagcgtggac ttctccctca gtggtcgcct gctgtttgct ggatacaatg attacactat caacgtctgg gatgttctca aagggtcccg ggtctccatc ctgtttggac atgaaaaccg cgttagcact ctacgagttt cccccgatgg gactgctttc tgctctggat catgggatca taccctcaga gtctgggcct aa. It is sometimes possible for the material contained within the vial of "GNB5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.