Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNB2L1 cdna clone

GNB2L1 cDNA Clone

Gene Names
RACK1; H12.3; HLC-7; PIG21; GNB2L1; Gnb2-rs1
Synonyms
GNB2L1; GNB2L1 cDNA Clone; GNB2L1 cdna clone
Ordering
For Research Use Only!
Sequence
atgactgagcagatgacccttcgtggcaccctcaagggccacaacggctgggtaacccagatcgctactaccccgcagttcccggacatgatcctctccgcctctcgagataagaccatcatcatgtggaaactgaccagggatgagaccaactatggaattccacagcgtgctctgcggggtcactcccactttgttagtgatgtggttatctcctcagatggccagtttgccctctcaggctcctgggatggaaccctgcgcctctgggatctcacaacgggcaccaccacgaggcgatttgtgggccataccaaggatgtgctgagtgtggccttctcctctgacaaccggcagattgtctctggatctcgagataaaaccatcaagctatggaataccctgggtgtgtgcaaatacactgtccaggatgagagccactcagagtgggtgtcttgtgtccgcttctcgcccaacagcagcaaccctatcatcgtctcctgtggctgggacaagctggtcaaggtatggaacctggctaactgcaagctgaagaccaaccacattggccacacaggctatctgaacacggtgactgtctctccagatggatccctctgtgcttctggaggcaaggatggccaggccatgttatgggatctcaacgaaggcaaacacctttacacgctagatggtggggacatcatcaacgccctgtgcttcagccctaaccgctactggctgtgtgctgccacaggccccagcatcaagatctgggatttagagggaaagatcattgtagatgaactgaagcaagaagttatcagtaccagcagcaaggcagaaccaccccagtgcacctccctggcctggtctgctgatggccagactctgtttgctggctacacggacaacctggtgcgagtgtggcaggtgaccattggcacacgctag
Sequence Length
954
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,077 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1, mRNA
NCBI Official Synonym Full Names
receptor for activated C kinase 1
NCBI Official Symbol
RACK1
NCBI Official Synonym Symbols
H12.3; HLC-7; PIG21; GNB2L1; Gnb2-rs1
NCBI Protein Information
receptor of activated protein C kinase 1
UniProt Protein Name
Receptor of activated protein C kinase 1
UniProt Gene Name
RACK1
UniProt Synonym Gene Names
HLC-7
UniProt Entry Name
RACK1_HUMAN

Uniprot Description

RACK1: a G-beta like protein containing 7 WD domains. A presumptive scaffold protein, linking protein kinase C to its substrates. Binds inositol 1,4,5-trisphosphate receptors and regulates Ca2+ release by enhancing inositol 1,4,5-trisphosphate receptor binding affinity for inositol 1,4,5-trisphosphate. An insulin-like growth factor 1 receptor-interacting protein that can regulate IGF-1-mediated Akt activation and protection from cell death.

Protein type: Nuclear receptor co-regulator; G protein, heterotrimeric; Adaptor/scaffold; G protein; G protein, heterotrimeric beta; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 5q35.3

Cellular Component: cell soma; cell-cell adherens junction; cytoplasm; cytosol; dendrite; midbody; mitochondrion; nucleus; perinuclear region of cytoplasm; phagocytic cup; small ribosomal subunit

Molecular Function: caspase activator activity; enzyme binding; ion channel inhibitor activity; protein binding; protein complex scaffold; protein homodimerization activity; protein kinase C binding; protein phosphatase binding; protein tyrosine kinase inhibitor activity; receptor tyrosine kinase binding; SH2 domain binding

Biological Process: caspase activation; negative regulation of cell growth; negative regulation of peptidyl-serine phosphorylation; negative regulation of phagocytosis; negative regulation of protein kinase B signaling cascade; negative regulation of translation; negative regulation of Wnt receptor signaling pathway; positive regulation of apoptosis; positive regulation of cAMP catabolic process; positive regulation of cell migration; positive regulation of cyclic-nucleotide phosphodiesterase activity; positive regulation of Golgi to plasma membrane protein transport; positive regulation of GTPase activity; positive regulation of mitochondrial depolarization; positive regulation of proteasomal ubiquitin-dependent protein catabolic process; positive regulation of protein amino acid phosphorylation; positive regulation of protein homooligomerization; regulation of cell cycle; regulation of cell division; regulation of protein localization

Research Articles on GNB2L1

Similar Products

Product Notes

The GNB2L1 rack1 (Catalog #AAA1276898) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgagc agatgaccct tcgtggcacc ctcaagggcc acaacggctg ggtaacccag atcgctacta ccccgcagtt cccggacatg atcctctccg cctctcgaga taagaccatc atcatgtgga aactgaccag ggatgagacc aactatggaa ttccacagcg tgctctgcgg ggtcactccc actttgttag tgatgtggtt atctcctcag atggccagtt tgccctctca ggctcctggg atggaaccct gcgcctctgg gatctcacaa cgggcaccac cacgaggcga tttgtgggcc ataccaagga tgtgctgagt gtggccttct cctctgacaa ccggcagatt gtctctggat ctcgagataa aaccatcaag ctatggaata ccctgggtgt gtgcaaatac actgtccagg atgagagcca ctcagagtgg gtgtcttgtg tccgcttctc gcccaacagc agcaacccta tcatcgtctc ctgtggctgg gacaagctgg tcaaggtatg gaacctggct aactgcaagc tgaagaccaa ccacattggc cacacaggct atctgaacac ggtgactgtc tctccagatg gatccctctg tgcttctgga ggcaaggatg gccaggccat gttatgggat ctcaacgaag gcaaacacct ttacacgcta gatggtgggg acatcatcaa cgccctgtgc ttcagcccta accgctactg gctgtgtgct gccacaggcc ccagcatcaa gatctgggat ttagagggaa agatcattgt agatgaactg aagcaagaag ttatcagtac cagcagcaag gcagaaccac cccagtgcac ctccctggcc tggtctgctg atggccagac tctgtttgct ggctacacgg acaacctggt gcgagtgtgg caggtgacca ttggcacacg ctag. It is sometimes possible for the material contained within the vial of "GNB2L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.