Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNAI2 cdna clone

GNAI2 cDNA Clone

Gene Names
GNAI2; GIP; GNAI2B; H_LUCA15.1; H_LUCA16.1
Synonyms
GNAI2; GNAI2 cDNA Clone; GNAI2 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtatgcagggcatcttcctgccagctctgcccagggcaccatattggcatgcaccagctgcacaggtgctggggagtcagggaagagcaccatcgtcaagcagatgaagatcatccacgaggatggctactccgaggaggaatgccggcagtaccgggcggttgtctacagcaacaccatccagtccatcatggccattgtcaaagccatgggcaacctgcagatcgactttgccgacccctccagagcggacgacgccaggcagctatttgcactgtcctgcaccgccgaggagcaaggcgtgctccctgatgacctgtccggcgtcatccggaggctctgggctgaccatggtgtgcaggcctgctttggccgctcaagggaataccagctcaacgactcagctgcctactacctgaacgacctggagcgtattgcacagagtgactacatccccacacagcaagatgtgctacggacccgcgtaaagaccacggggatcgtggagacacacttcaccttcaaggacctacacttcaagatgtttgatgtgggtggtcagcggtctgagcggaagaagtggatccactgctttgagggcgtcacagccatcatcttctgcgtagccttgagcgcctatgacttggtgctagctgaggacgaggagatgaaccgcatgcatgagagcatgaagctattcgatagcatctgcaacaacaagtggttcacagacacgtccatcatcctcttcctcaacaagaaggacctgtttgaggagaagatcacacacagtcccctgaccatctgcttccctgagtacacaggggccaacaaatatgatgaggcagccagctacatccagagtaagtttgaggacctgaataagcgcaaagacaccaaggagatctacacgcacttcacgtgcgccaccgacaccaagaacgtgcagttcgtgtttgacgccgtcaccgatgtcatcatcaagaacaacctgaaggactgcggcctcttctga
Sequence Length
1020
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,935 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2, mRNA
NCBI Official Synonym Full Names
G protein subunit alpha i2
NCBI Official Symbol
GNAI2
NCBI Official Synonym Symbols
GIP; GNAI2B; H_LUCA15.1; H_LUCA16.1
NCBI Protein Information
guanine nucleotide-binding protein G(i) subunit alpha-2
UniProt Protein Name
Guanine nucleotide-binding protein G(i) subunit alpha-2
UniProt Gene Name
GNAI2
UniProt Synonym Gene Names
GNAI2B
UniProt Entry Name
GNAI2_HUMAN

NCBI Description

The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

Uniprot Description

G-alpha i2: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. The G(i) proteins are involved in hormonal regulation of adenylate cyclase: they inhibit the cyclase in response to beta-adrenergic stimuli. May play a role in cell division. Belongs to the G-alpha family. G(i/o/t/z) subfamily. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein, heterotrimeric; G protein, heterotrimeric alpha G((i/o/t/z)); G protein

Chromosomal Location of Human Ortholog: 3p21.31

Cellular Component: centrosome; cytoplasm; heterotrimeric G-protein complex; membrane; midbody; nucleoplasm; plasma membrane

Molecular Function: G-protein beta/gamma-subunit binding; G-protein-coupled receptor binding; GTP binding; GTPase activity; protein binding; signal transducer activity

Biological Process: adenosine receptor signaling pathway; cell division; G-protein coupled receptor protein signaling pathway; G-protein signaling, adenylate cyclase inhibiting pathway; gamma-aminobutyric acid signaling pathway; negative regulation of adenylate cyclase activity; protein folding; response to nutrient; signal transduction

Disease: Ventricular Tachycardia, Familial

Research Articles on GNAI2

Similar Products

Product Notes

The GNAI2 gnai2 (Catalog #AAA1278705) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtatg cagggcatct tcctgccagc tctgcccagg gcaccatatt ggcatgcacc agctgcacag gtgctgggga gtcagggaag agcaccatcg tcaagcagat gaagatcatc cacgaggatg gctactccga ggaggaatgc cggcagtacc gggcggttgt ctacagcaac accatccagt ccatcatggc cattgtcaaa gccatgggca acctgcagat cgactttgcc gacccctcca gagcggacga cgccaggcag ctatttgcac tgtcctgcac cgccgaggag caaggcgtgc tccctgatga cctgtccggc gtcatccgga ggctctgggc tgaccatggt gtgcaggcct gctttggccg ctcaagggaa taccagctca acgactcagc tgcctactac ctgaacgacc tggagcgtat tgcacagagt gactacatcc ccacacagca agatgtgcta cggacccgcg taaagaccac ggggatcgtg gagacacact tcaccttcaa ggacctacac ttcaagatgt ttgatgtggg tggtcagcgg tctgagcgga agaagtggat ccactgcttt gagggcgtca cagccatcat cttctgcgta gccttgagcg cctatgactt ggtgctagct gaggacgagg agatgaaccg catgcatgag agcatgaagc tattcgatag catctgcaac aacaagtggt tcacagacac gtccatcatc ctcttcctca acaagaagga cctgtttgag gagaagatca cacacagtcc cctgaccatc tgcttccctg agtacacagg ggccaacaaa tatgatgagg cagccagcta catccagagt aagtttgagg acctgaataa gcgcaaagac accaaggaga tctacacgca cttcacgtgc gccaccgaca ccaagaacgt gcagttcgtg tttgacgccg tcaccgatgt catcatcaag aacaacctga aggactgcgg cctcttctga. It is sometimes possible for the material contained within the vial of "GNAI2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.