Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GMPPB cdna clone

GMPPB cDNA Clone

Gene Names
GMPPB; MDDGA14; MDDGB14; MDDGC14
Synonyms
GMPPB; GMPPB cDNA Clone; GMPPB cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggcactgatcttagtggggggctatgggacgcggctacggccgctgacgctgagcaccccgaagccactggtggacttctgcaataagcccatcttgctgcaccaagtggaggcgctagccgcggcaggcgtggaccacgtgatcctggccgtgagctacatgtcgcaggtgctggagaaggaaatgaaggcacaggagcagaggctgggaatccgaatctccatgtcccatgaagaggagcctttggggacagctgggcccctggcgctggcccgtgacctactctctgagactgcagaccctttcttcgtcctcaacagtgacgtgatctgcgatttccccttccaagccatggtgcagttccaccggcaccatggccaggagggctccatcctggtgaccaaggtggaggaaccctccaagtacggtgtggtggtgtgtgaggctgacacaggccgcattcaccggttcgtggagaagccacaggtgtttgtgtccaataagatcaacgcaggcatgtacatcctgagccctgcagtgctgcggcgcatccagctgcagcctacgtccattgagaaggaggtcttccccattatggccaaggaggggcagctatatgccatggagttacagggcttctggatggacattgggcagcccaaggacttcctcactggcatgtgcctcttcctgcagtcactgaggcagaagcagcctgagcggctgtgctcaggccctggcattgtgggcaacgtgctggtggacccaagtgcccgcatcggccagaactgcagcattggccccaatgtgagcctgggacctggcgtggtggtcgaagatggtgtgtgtatccggcggtgcacggtgctgcgggatgcccggatccgttcccattcctggcttgagtcctgcattgtgggctggcgctgccgcgtgggtcagtgggtacgcatggagaacgtgacagtgctgggtgaggacgtcatagttaatgatgagctctacctcaacggagccagcgtgctgccccacaagtctattggcgagtcagtgccagagcctcgtatcatcatgtga
Sequence Length
1083
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,622 Da
NCBI Official Full Name
Homo sapiens GDP-mannose pyrophosphorylase B, mRNA
NCBI Official Synonym Full Names
GDP-mannose pyrophosphorylase B
NCBI Official Symbol
GMPPB
NCBI Official Synonym Symbols
MDDGA14; MDDGB14; MDDGC14
NCBI Protein Information
mannose-1-phosphate guanyltransferase beta
UniProt Protein Name
Mannose-1-phosphate guanyltransferase beta
UniProt Gene Name
GMPPB
UniProt Entry Name
GMPPB_HUMAN

NCBI Description

This gene is thought to encode a GDP-mannose pyrophosphorylase. The encoded protein catalyzes the conversion of mannose-1-phosphate and GTP to GDP-mannose, a reaction involved in the production of N-linked oligosaccharides. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2009]

Uniprot Description

GMPPB: This gene is thought to encode a GDP-mannose pyrophosphorylase. The encoded protein catalyzes the conversion of mannose-1-phosphate and GTP to GDP-mannose, a reaction involved in the production of N-linked oligosaccharides. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2009]

Protein type: Motility/polarity/chemotaxis; Carbohydrate Metabolism - amino sugar and nucleotide sugar; Transferase; Carbohydrate Metabolism - fructose and mannose; EC 2.7.7.13

Chromosomal Location of Human Ortholog: 3p21.31

Cellular Component: cytoplasm

Molecular Function: protein binding

Disease: Muscular Dystrophy-dystroglycanopathy (congenital With Brain And Eye Anomalies), Type A, 14; Muscular Dystrophy-dystroglycanopathy (congenital With Mental Retardation), Type B, 14; Muscular Dystrophy-dystroglycanopathy (limb-girdle), Type C, 14

Research Articles on GMPPB

Similar Products

Product Notes

The GMPPB gmppb (Catalog #AAA1277720) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggcac tgatcttagt ggggggctat gggacgcggc tacggccgct gacgctgagc accccgaagc cactggtgga cttctgcaat aagcccatct tgctgcacca agtggaggcg ctagccgcgg caggcgtgga ccacgtgatc ctggccgtga gctacatgtc gcaggtgctg gagaaggaaa tgaaggcaca ggagcagagg ctgggaatcc gaatctccat gtcccatgaa gaggagcctt tggggacagc tgggcccctg gcgctggccc gtgacctact ctctgagact gcagaccctt tcttcgtcct caacagtgac gtgatctgcg atttcccctt ccaagccatg gtgcagttcc accggcacca tggccaggag ggctccatcc tggtgaccaa ggtggaggaa ccctccaagt acggtgtggt ggtgtgtgag gctgacacag gccgcattca ccggttcgtg gagaagccac aggtgtttgt gtccaataag atcaacgcag gcatgtacat cctgagccct gcagtgctgc ggcgcatcca gctgcagcct acgtccattg agaaggaggt cttccccatt atggccaagg aggggcagct atatgccatg gagttacagg gcttctggat ggacattggg cagcccaagg acttcctcac tggcatgtgc ctcttcctgc agtcactgag gcagaagcag cctgagcggc tgtgctcagg ccctggcatt gtgggcaacg tgctggtgga cccaagtgcc cgcatcggcc agaactgcag cattggcccc aatgtgagcc tgggacctgg cgtggtggtc gaagatggtg tgtgtatccg gcggtgcacg gtgctgcggg atgcccggat ccgttcccat tcctggcttg agtcctgcat tgtgggctgg cgctgccgcg tgggtcagtg ggtacgcatg gagaacgtga cagtgctggg tgaggacgtc atagttaatg atgagctcta cctcaacgga gccagcgtgc tgccccacaa gtctattggc gagtcagtgc cagagcctcg tatcatcatg tga. It is sometimes possible for the material contained within the vial of "GMPPB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.