Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GLTP cdna clone

GLTP cDNA Clone

Synonyms
GLTP; GLTP cDNA Clone; GLTP cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctgctggccgaacacttgctgaagccgctgcccgcggacaagcagatcgagaccgggcccttcctcgaggcggtgtcccacctgccgcccttcttcgattgccttgggtccccagtgtttactcccatcaaggcagacataagcggcaacatcacgaaaatcaaagctgtgtacgacaccaacccagccaagttccggaccctgcagaacatcctggaggtggagaaagaaatgtatggagcagagtggcccaaagtaggggccacactggcgctgatgtggctgaaaagaggcctccgcttcatccaggtcttcctccagagcatctgcgacggggagcgggacgagaaccaccccaacctcatccgtgtcaacgccaccaaggcctacgagatggccctcaagaagtaccatggctggatcgtgcagaagatcttccaggcagcactgtacgcagcaccctataagtctgacttcctgaaagcgctctccaaggggcagaatgttacggaggaggagtgcctggagaagatccgcctcttcctagtcaactacacggcgaccatcgatgtcatctacgagatgtacacccagatgaacgctgagcttaactacaaggtgtag
Sequence Length
630
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,850 Da
NCBI Official Full Name
Homo sapiens glycolipid transfer protein, mRNA
NCBI Official Synonym Full Names
glycolipid transfer protein
NCBI Official Symbol
GLTP
NCBI Protein Information
glycolipid transfer protein
UniProt Protein Name
Glycolipid transfer protein
UniProt Gene Name
GLTP
UniProt Synonym Gene Names
GLTP
UniProt Entry Name
GLTP_HUMAN

NCBI Description

The protein encoded by this gene is similar to bovine and porcine proteins which accelerate transfer of certain glycosphingolipids and glyceroglycolipids between membranes. It is thought to be a cytoplasmic protein. [provided by RefSeq, Jul 2008]

Uniprot Description

GLTP: Accelerates the intermembrane transfer of various glycolipids. Catalyzes the transfer of various glycosphingolipids between membranes but does not catalyze the transfer of phospholipids. May be involved in the intracellular translocation of glucosylceramides. Belongs to the GLTP family.

Chromosomal Location of Human Ortholog: 12q24.11

Cellular Component: cytosol; membrane

Molecular Function: glycolipid binding; glycolipid transporter activity; lipid binding; protein binding

Biological Process: glycolipid transport; glycosphingolipid metabolic process

Research Articles on GLTP

Similar Products

Product Notes

The GLTP gltp (Catalog #AAA1266452) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctgc tggccgaaca cttgctgaag ccgctgcccg cggacaagca gatcgagacc gggcccttcc tcgaggcggt gtcccacctg ccgcccttct tcgattgcct tgggtcccca gtgtttactc ccatcaaggc agacataagc ggcaacatca cgaaaatcaa agctgtgtac gacaccaacc cagccaagtt ccggaccctg cagaacatcc tggaggtgga gaaagaaatg tatggagcag agtggcccaa agtaggggcc acactggcgc tgatgtggct gaaaagaggc ctccgcttca tccaggtctt cctccagagc atctgcgacg gggagcggga cgagaaccac cccaacctca tccgtgtcaa cgccaccaag gcctacgaga tggccctcaa gaagtaccat ggctggatcg tgcagaagat cttccaggca gcactgtacg cagcacccta taagtctgac ttcctgaaag cgctctccaa ggggcagaat gttacggagg aggagtgcct ggagaagatc cgcctcttcc tagtcaacta cacggcgacc atcgatgtca tctacgagat gtacacccag atgaacgctg agcttaacta caaggtgtag. It is sometimes possible for the material contained within the vial of "GLTP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.