Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GEMIN6 cdna clone

GEMIN6 cDNA Clone

Synonyms
GEMIN6; GEMIN6 cDNA Clone; GEMIN6 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgaatggatgaagaaaggccccttagaatggcaagattacatttacaaagaggtccgagtgacagccagtgagaagaatgagtataaaggatgggttttaactacagacccagtctctgccaatattgtccttgtgaacttccttgaagatggcagcatgtctgtgaccggaattatgggacatgctgtgcagactgttgaaactatgaatgaaggggaccatagagtgagggagaagctgatgcatttgttcacgtctggagactgcaaagcatacagcccagaggatctggaagagagaaagaacagcctaaagaaatggcttgagaagaaccacatccccatcactgaacagggagacgctccaaggactctctgtgtggctggggtcctgactatagacccaccatatgatccagaaaattgcagcagctctaatgagattattctgtcgcgtgttcaggatcttattgaaggacatcttacagcttcccaatga
Sequence Length
504
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,824 Da
NCBI Official Full Name
Homo sapiens gem (nuclear organelle) associated protein 6, mRNA
NCBI Official Synonym Full Names
gem nuclear organelle associated protein 6
NCBI Official Symbol
GEMIN6
NCBI Protein Information
gem-associated protein 6
UniProt Protein Name
Gem-associated protein 6
Protein Family
UniProt Gene Name
GEMIN6
UniProt Synonym Gene Names
Gemin-6
UniProt Entry Name
GEMI6_HUMAN

NCBI Description

GEMIN6 is part of a large macromolecular complex, localized to both the cytoplasm and the nucleus, that plays a role in the cytoplasmic assembly of small nuclear ribonucleoproteins (snRNPs). Other members of this complex include SMN (MIM 600354), GEMIN2 (SIP1; MIM 602595), GEMIN3 (DDX20; MIM 606168), GEMIN4 (MIM 606969), and GEMIN5 (MIM 607005).[supplied by OMIM, Jul 2002]

Uniprot Description

GEMIN6: The SMN complex plays an essential role in spliceosomal snRNP assembly in the cytoplasm and is required for pre-mRNA splicing in the nucleus.

Protein type: RNA splicing

Chromosomal Location of Human Ortholog: 2p22.1

Cellular Component: cytoplasm; cytosol; nuclear body; nucleoplasm; SMN complex

Molecular Function: protein binding

Biological Process: nuclear import; nuclear mRNA splicing, via spliceosome; spliceosomal snRNP biogenesis

Research Articles on GEMIN6

Similar Products

Product Notes

The GEMIN6 gemin6 (Catalog #AAA1269953) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgaat ggatgaagaa aggcccctta gaatggcaag attacattta caaagaggtc cgagtgacag ccagtgagaa gaatgagtat aaaggatggg ttttaactac agacccagtc tctgccaata ttgtccttgt gaacttcctt gaagatggca gcatgtctgt gaccggaatt atgggacatg ctgtgcagac tgttgaaact atgaatgaag gggaccatag agtgagggag aagctgatgc atttgttcac gtctggagac tgcaaagcat acagcccaga ggatctggaa gagagaaaga acagcctaaa gaaatggctt gagaagaacc acatccccat cactgaacag ggagacgctc caaggactct ctgtgtggct ggggtcctga ctatagaccc accatatgat ccagaaaatt gcagcagctc taatgagatt attctgtcgc gtgttcagga tcttattgaa ggacatctta cagcttccca atga. It is sometimes possible for the material contained within the vial of "GEMIN6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.