Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GATAD1 cdna clone

GATAD1 cDNA Clone

Gene Names
GATAD1; ODAG; CMD2B; RG083M05.2
Synonyms
GATAD1; GATAD1 cDNA Clone; GATAD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgctgggcctgaagcccacctgcagcgtatgcaagaccacgtcgtcctccatgtggaagaagggagcgcagggggagatcctctgccatcattgcactggccggggcggcgcgggcagcgggggcgcaggctcgggggcggctggagggactgggggcagcggcggcggcggcttcggcgcggcgaccttcgccagcacctccgccacccctccgcagagcaacgggggcgggggcggcaagcagagtaagcaggaaattcacaggaggtctgctcggctcagaaacactaaatacaaatctgctccggctgctgaaaagaaagtctccaccaaaggaaaagggagaagacatatatttaaattgaaaaatcccatcaaagctcctgagtcagtttccactataatcactgcagaatcaatcttctacaagggagtatattaccaaattggtgatgttgtttctgtgattgatgaacaagatggaaagccctactatgctcaaatcagaggttttatccaggaccagtattgcgagaagagtgcagcactgacgtggctcattcctaccctctctagccccagagaccaatttgatcccgcctcctatatcatagggccagaggaagatcttccaaggaagatggaatacttggaatttgtttgtcatgcaccttctgagtatttcaagtcacggtcatcaccatttcccacagttcccaccagaccagagaagggctacatatggactcatgttgggcctactcctgcaataacaattaaggaatcagttgccaaccatttgtag
Sequence Length
810
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,690 Da
NCBI Official Full Name
Homo sapiens GATA zinc finger domain containing 1, mRNA
NCBI Official Synonym Full Names
GATA zinc finger domain containing 1
NCBI Official Symbol
GATAD1
NCBI Official Synonym Symbols
ODAG; CMD2B; RG083M05.2
NCBI Protein Information
GATA zinc finger domain-containing protein 1
UniProt Protein Name
GATA zinc finger domain-containing protein 1
UniProt Gene Name
GATAD1
UniProt Synonym Gene Names
ODAG
UniProt Entry Name
GATD1_HUMAN

NCBI Description

The protein encoded by this gene contains a zinc finger at the N-terminus, and is thought to bind to a histone modification site that regulates gene expression. Mutations in this gene have been associated with autosomal recessive dilated cardiomyopathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]

Uniprot Description

GATAD1: Component of some chromatin complex recruited to chromatin sites methylated 'Lys-4' of histone H3 (H3K4me). Defects in GATAD1 are the cause of cardiomyopathy, dilated type 2B (CMD2B). CMD2B is a disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death.

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: 7q21-q22

Cellular Component: nucleoplasm; nucleus

Disease: Cardiomyopathy, Dilated, 2b

Research Articles on GATAD1

Similar Products

Product Notes

The GATAD1 gatad1 (Catalog #AAA1269799) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgctgg gcctgaagcc cacctgcagc gtatgcaaga ccacgtcgtc ctccatgtgg aagaagggag cgcaggggga gatcctctgc catcattgca ctggccgggg cggcgcgggc agcgggggcg caggctcggg ggcggctgga gggactgggg gcagcggcgg cggcggcttc ggcgcggcga ccttcgccag cacctccgcc acccctccgc agagcaacgg gggcgggggc ggcaagcaga gtaagcagga aattcacagg aggtctgctc ggctcagaaa cactaaatac aaatctgctc cggctgctga aaagaaagtc tccaccaaag gaaaagggag aagacatata tttaaattga aaaatcccat caaagctcct gagtcagttt ccactataat cactgcagaa tcaatcttct acaagggagt atattaccaa attggtgatg ttgtttctgt gattgatgaa caagatggaa agccctacta tgctcaaatc agaggtttta tccaggacca gtattgcgag aagagtgcag cactgacgtg gctcattcct accctctcta gccccagaga ccaatttgat cccgcctcct atatcatagg gccagaggaa gatcttccaa ggaagatgga atacttggaa tttgtttgtc atgcaccttc tgagtatttc aagtcacggt catcaccatt tcccacagtt cccaccagac cagagaaggg ctacatatgg actcatgttg ggcctactcc tgcaataaca attaaggaat cagttgccaa ccatttgtag. It is sometimes possible for the material contained within the vial of "GATAD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.