FTSJ3 cdna clone
FTSJ3 cDNA Clone
Gene Names
FTSJ3; SPB1; EPCS3
Synonyms
FTSJ3; FTSJ3 cDNA Clone; FTSJ3 cdna clone
Sequence
atggtagatgatgaagagttggcacagcatccagctaccactgaggacatacgggtgtgctgtcaggacatcagagtgttggggcgcaaggagctcaggtcgctactaaactggagaacaaaacttcggcgatatgtggccaagaagctgaaagaacaagcaaaggcactggacatcagcctcagctctggagaggaagatgaaggtgatgaggaggactcaacagctggaaccacaaagcagccctctaaggaggaggaggaagaggaggaggaggaacaactgaaccagaccttggcagaaatgaaggcccaggaggtggcggaattgaagaggaagaaaaagaagctgttgcgtgagcagagaaagcagcgggagcgtgtggagctgaagatggatctgcctggggtttccattgcagacgagggggagactggcatgttctccttgtgcaccatccggggtcaccagttattagaggaagtaacacaaggggatatgagtgcagcagacacatttctgtccgatctgccaagggatgatatctatgtgtcagatgttgaggacgacggtgatgacacatctctggatagtgacctggatccagaggagctggcaggagtcaggggacatcagggtctaagggaccaaaagcgtatgcgacttactgaagtgcaagatgataaagaggaggaggaggaggagaatccactgctggtaccactggaggaaaaggcagtactgcaggaagaacaagccaacctgtggttctcaaagggcagctttgctgggatcgaggacgatgccgatgaggccctggagatcagtcaggcccagctgttatttgagaaccggcggaagggacggcagcagcagcagaagcagcagctgccacagacacccccttcctgtttgaagactgagataatgtctcccctgtaccaagatgaagcccctaagggaacagaggcttcttcggggacagaagctgccactggccttgaaggggaagaaaaggatggcatctcagacagtgatagcagtactagcagtgaggaagaagagagctgggaacccctccgtggtaagaagcgaagccgtgggcctaagtcagatgatgacgggtttgagatagtgcctattgaggacccagcgaaacatcggatactggaccccgaaggccttgctctaggtgctgttattgcctcttccaaaaaggccaagagagacctcatagataactccttcaaccggtacacatttaatgaggatgagggggagcttccggagtggtttgtgcaagaggaaaagcagcaccggatacgacagttgcctgttggtaagaaggaggtggagcattaccggaaacgctggcgggaaatcaatgcacgtcccatcaagaaggtggctgaggctaaggctagaaagaaaaggaggatgctgaagaggctggagcagaccaggaagaaggcagaagccgtggtgaacacagtggacatctcagaacgagagaaagtggcacagctgcgaagtctctacaagaaggctgggcttggcaaggagaaacgccatgtcacctacgttgtagccaaaaaaggtgtgggccgcaaagtgcgccggccagctggagtcagaggtcatttcaaggtggtggactcaaggatgaagaaggaccaaagagcacagcaacgtaaggaacaaaagaaaaaacacaaacggaagtaa
Sequence Length
1725
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
96,558 Da
NCBI Official Full Name
Homo sapiens FtsJ homolog 3 (E. coli), mRNA
NCBI Official Synonym Full Names
FtsJ homolog 3
NCBI Official Symbol
FTSJ3
NCBI Official Synonym Symbols
SPB1; EPCS3
NCBI Protein Information
pre-rRNA processing protein FTSJ3
UniProt Protein Name
pre-rRNA processing protein FTSJ3
Protein Family
UniProt Gene Name
FTSJ3
UniProt Entry Name
SPB1_HUMAN
NCBI Description
Although the function of this gene is not known, the existence of this gene is supported by mRNA and EST data. A possible function of the encoded protein can be inferred from amino acid sequence similarity to the E.coli FtsJ protein and to a mouse protein possibly involved in embryogenesis. [provided by RefSeq, Jul 2008]
Uniprot Description
FTSJ3: Probable methyltransferase involved in the processing of the 34S pre-rRNA to 18S rRNA. Belongs to the methyltransferase superfamily. RlmE family.
Protein type: RNA-binding; Motility/polarity/chemotaxis; Nucleolus; Methyltransferase; EC 2.1.1.-
Chromosomal Location of Human Ortholog: 17q23.3
Cellular Component: nucleolus; nucleus
Molecular Function: protein binding; rRNA (guanine) methyltransferase activity; rRNA (uridine-2'-O-)-methyltransferase activity
Biological Process: maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); rRNA methylation
Research Articles on FTSJ3
Similar Products
Product Notes
The FTSJ3 ftsj3 (Catalog #AAA1273200) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtagatg atgaagagtt ggcacagcat ccagctacca ctgaggacat acgggtgtgc tgtcaggaca tcagagtgtt ggggcgcaag gagctcaggt cgctactaaa ctggagaaca aaacttcggc gatatgtggc caagaagctg aaagaacaag caaaggcact ggacatcagc ctcagctctg gagaggaaga tgaaggtgat gaggaggact caacagctgg aaccacaaag cagccctcta aggaggagga ggaagaggag gaggaggaac aactgaacca gaccttggca gaaatgaagg cccaggaggt ggcggaattg aagaggaaga aaaagaagct gttgcgtgag cagagaaagc agcgggagcg tgtggagctg aagatggatc tgcctggggt ttccattgca gacgaggggg agactggcat gttctccttg tgcaccatcc ggggtcacca gttattagag gaagtaacac aaggggatat gagtgcagca gacacatttc tgtccgatct gccaagggat gatatctatg tgtcagatgt tgaggacgac ggtgatgaca catctctgga tagtgacctg gatccagagg agctggcagg agtcagggga catcagggtc taagggacca aaagcgtatg cgacttactg aagtgcaaga tgataaagag gaggaggagg aggagaatcc actgctggta ccactggagg aaaaggcagt actgcaggaa gaacaagcca acctgtggtt ctcaaagggc agctttgctg ggatcgagga cgatgccgat gaggccctgg agatcagtca ggcccagctg ttatttgaga accggcggaa gggacggcag cagcagcaga agcagcagct gccacagaca cccccttcct gtttgaagac tgagataatg tctcccctgt accaagatga agcccctaag ggaacagagg cttcttcggg gacagaagct gccactggcc ttgaagggga agaaaaggat ggcatctcag acagtgatag cagtactagc agtgaggaag aagagagctg ggaacccctc cgtggtaaga agcgaagccg tgggcctaag tcagatgatg acgggtttga gatagtgcct attgaggacc cagcgaaaca tcggatactg gaccccgaag gccttgctct aggtgctgtt attgcctctt ccaaaaaggc caagagagac ctcatagata actccttcaa ccggtacaca tttaatgagg atgaggggga gcttccggag tggtttgtgc aagaggaaaa gcagcaccgg atacgacagt tgcctgttgg taagaaggag gtggagcatt accggaaacg ctggcgggaa atcaatgcac gtcccatcaa gaaggtggct gaggctaagg ctagaaagaa aaggaggatg ctgaagaggc tggagcagac caggaagaag gcagaagccg tggtgaacac agtggacatc tcagaacgag agaaagtggc acagctgcga agtctctaca agaaggctgg gcttggcaag gagaaacgcc atgtcaccta cgttgtagcc aaaaaaggtg tgggccgcaa agtgcgccgg ccagctggag tcagaggtca tttcaaggtg gtggactcaa ggatgaagaa ggaccaaaga gcacagcaac gtaaggaaca aaagaaaaaa cacaaacgga agtaa. It is sometimes possible for the material contained within the vial of "FTSJ3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
