Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FPR3 cdna clone

FPR3 cDNA Clone

Gene Names
FPR3; FMLPY; FPRH1; FPRH2; FPRL2; RMLP-R-I; FMLP-R-II; FML2_HUMAN
Synonyms
FPR3; FPR3 cDNA Clone; FPR3 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaaccaacttctccattcctctgaatgaaactgaggaggtgctccctgagcctgctggccacaccgttctgtggatcttctcattgctagtccacggagtcacctttgtcttcggggtcctgggcaatgggcttgtgatctgggtggctggattccggatgacacgcacagtcaacaccatctgttacctgaacctggccctagctgacttctctttcagtgccatcctaccattccgaatggtctcagtcgccatgagagaaaaatggccttttggctcattcctatgtaagttagttcatgttatgatagacatcaacctgtttgtcagtgtctacctgatcaccatcattgctctggaccgctgtatttgtgtcctgcatccagcctgggcccagaaccatcgcaccatgagtctggccaagagggtgatgacgggactctggattttcaccatagtccttaccttaccaaatttcatcttctggactacaataagtactacgaatggggacacatactgtattttcaactttgcattctggggtgacactgctgtagagaggttgaacgtgttcattaccatggccaaggtctttctgatcctccacttcattattggcttcagcgtgcctatgtccatcatcacagtctgctatgggatcatcgctgccaaaattcacagaaaccacatgattaaatccagccgtcccttacgtgtcttcgctgctgtggtggcttctttcttcatctgttggttcccttatgaactaattggcattctaatggcagtctggctcaaagagatgttgttaaatggcaaatacaaaatcattcttgtcctgattaacccaacaagctccttggccttttttaacagctgcctcaacccaattctctacgtctttatgggtcgtaacttccaagaaagactgattcgctctttgcccactagtttggagagggccctgactgaggtccctgactcagcccagaccagcaacacagacaccacttctgcttcacctcctgaggagacggagttacaagcaatgtga
Sequence Length
1062
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,965 Da
NCBI Official Full Name
Homo sapiens formyl peptide receptor 3, mRNA
NCBI Official Synonym Full Names
formyl peptide receptor 3
NCBI Official Symbol
FPR3
NCBI Official Synonym Symbols
FMLPY; FPRH1; FPRH2; FPRL2; RMLP-R-I; FMLP-R-II; FML2_HUMAN
NCBI Protein Information
N-formyl peptide receptor 3
UniProt Protein Name
N-formyl peptide receptor 3
Protein Family
UniProt Gene Name
FPR3
UniProt Synonym Gene Names
FPRH1; FPRL2; FMLP-R-II
UniProt Entry Name
FPR3_HUMAN

Uniprot Description

FPR3: Low affinity receptor for N-formyl-methionyl peptides, which are powerful neutrophils chemotactic factors. Binding of FMLP to the receptor causes activation of neutrophils. This response is mediated via a G-protein that activates a phosphatidylinositol-calcium second messenger system. Belongs to the G-protein coupled receptor 1 family.

Protein type: Membrane protein, multi-pass; GPCR, family 1; Membrane protein, integral; Receptor, GPCR; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 19q13.3-q13.4

Cellular Component: plasma membrane

Biological Process: cell motility; signal transduction

Research Articles on FPR3

Similar Products

Product Notes

The FPR3 fpr3 (Catalog #AAA1275577) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaacca acttctccat tcctctgaat gaaactgagg aggtgctccc tgagcctgct ggccacaccg ttctgtggat cttctcattg ctagtccacg gagtcacctt tgtcttcggg gtcctgggca atgggcttgt gatctgggtg gctggattcc ggatgacacg cacagtcaac accatctgtt acctgaacct ggccctagct gacttctctt tcagtgccat cctaccattc cgaatggtct cagtcgccat gagagaaaaa tggccttttg gctcattcct atgtaagtta gttcatgtta tgatagacat caacctgttt gtcagtgtct acctgatcac catcattgct ctggaccgct gtatttgtgt cctgcatcca gcctgggccc agaaccatcg caccatgagt ctggccaaga gggtgatgac gggactctgg attttcacca tagtccttac cttaccaaat ttcatcttct ggactacaat aagtactacg aatggggaca catactgtat tttcaacttt gcattctggg gtgacactgc tgtagagagg ttgaacgtgt tcattaccat ggccaaggtc tttctgatcc tccacttcat tattggcttc agcgtgccta tgtccatcat cacagtctgc tatgggatca tcgctgccaa aattcacaga aaccacatga ttaaatccag ccgtccctta cgtgtcttcg ctgctgtggt ggcttctttc ttcatctgtt ggttccctta tgaactaatt ggcattctaa tggcagtctg gctcaaagag atgttgttaa atggcaaata caaaatcatt cttgtcctga ttaacccaac aagctccttg gcctttttta acagctgcct caacccaatt ctctacgtct ttatgggtcg taacttccaa gaaagactga ttcgctcttt gcccactagt ttggagaggg ccctgactga ggtccctgac tcagcccaga ccagcaacac agacaccact tctgcttcac ctcctgagga gacggagtta caagcaatgt ga. It is sometimes possible for the material contained within the vial of "FPR3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.