FMNL2 cdna clone

FMNL2 cDNA Clone

Cat. Num. AAA1266589

• Gene Names: FMNL2; FHOD2
• Synonyms: FMNL2; FMNL2 cDNA Clone; FMNL2 cdna clone

• Sequence: atggacttgaccaagagagagtacaccatgcatgaccataacacgctgctgaaggagttcatcctcaacaatgaggggaagctgaagaagctgcaggatgatgccaagatcgcacaggatgcctttgatgatgttgtgaagtattttggagaaaaccccaagacaacaccaccctctgtcttctttcctgtctttgtccggtttgtgaaagcatataagcaagcagaagaggaaaatgagctgaggaaaaagcaggaacaagctctcatggaaaaactcctagagcaagaagctctgatggagcagcaggatccaaagtctccttctcataaatcaaagaggcagcagcaagagttaattgcagaattaagaagacgacaagttaaagataacagacatgtatatgagggaaaagatggtgccattgaagatattatcacagccttaaagaagaataatatcactaaatttccaaatgttcactcgagggtaaggatttcttctagcacaccggtggtggaggatacacagagctga
• Sequence Length: 537

• Vector: pENTR223.1
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 34193784
• NCBI GeneID: 114793
• Molecular Weight: 124,107 Da
• NCBI Official Full Name: Homo sapiens formin-like 2, mRNA
• NCBI Official Synonym Full Names: formin like 2
• NCBI Official Symbol: FMNL2
• NCBI Official Synonym Symbols: FHOD2
• NCBI Protein Information: formin-like protein 2
• UniProt Protein Name: Formin-like protein 2
• UniProt Gene Name: FMNL2
• UniProt Synonym Gene Names: FHOD2; KIAA1902
• UniProt Entry Name: FMNL2_HUMAN

NCBI Description

This gene encodes a formin-related protein. Formin-related proteins have been implicated in morphogenesis, cytokinesis, and cell polarity. Alternatively spliced transcript variants encoding different isoforms have been described but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]

Uniprot Description

FMNL2: Plays a role in the regulation of cell morphology and cytoskeletal organization. Required in the cortical actin filament dynamics. Belongs to the formin homology family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 2q23.3

Cellular Component: cell-cell adherens junction; cytosol

Biological Process: cortical actin cytoskeleton organization and biogenesis; cytoskeleton organization and biogenesis; regulation of cell morphogenesis