FGD5 cdna clone
FGD5 cDNA Clone
Gene Names
FGD5; ZFYVE23
Synonyms
FGD5; FGD5 cDNA Clone; FGD5 cdna clone
Sequence
atgagggccttggatgacatggaccatgaaggcagagacacattggcccgggaggagctgaggcagggcctgagtgaactcccagccatccacgaccttcatcaaggcatcctggaggagctggaggaaaggctgtcaaattgggagagccagcagaaggtagctgacgtcttccttgcccgggagcaggggtttgatcaccacgccactcacatcctgcagttcgacaggtacctaggtctgctcagtgagaattgcctccactctccccggctggcagctgctgtccgtgaatttgagcagagtgtacaaggaggcagccagactgcgaagcatcggctgctgcgggtggttcaacgcctcttccagtaccaagtgctcctcacagactatttaaacaacctttgtccggactccgccgagtacgacaacacacagggtgcactgagcctcatctccaaagtcacagaccgtgccaacgacagcatggagcaaggggaaaacctgcagaagctggtccacattgagcacagcgtccggggccaaggggatctcctccagccaggaagggagtttctgaaggaagggacgctgatgaaagtaacagggaaaaacagacggccccggcacctatttctgatgaacgatgtgctcctgtacacctatccccagaaggatgggaagtaccggctgaagaacacattggctgtggccaacatgaaggtcagccgccctgtgatggagaaagtgccctacgctctaaagattgagacttccgagtcctgcctgatgctgtctgcgagctcctgtgcagagagggacgagtggtatggctgtctgagcagagccctccctgaggactacaaggcccaggcgctggctgcattccaccatagcgtggagatacgagagaggctgggggttagccttggggagaggccccccaccctggtgcctgtcacacacgtcatgatgtgcatgaactgcggctgcgacttctccctcaccctgcggcgtcatcactgtcacgcctgtggcaagatcgtgtgccggaactgttcgcggaacaagtacccgctgaagtacctgaaggacaggatggccaaggtctgcgacggctgcttcggggagctgaagaagcggggcagggctgtcccgggcctgatgagagagcggcctgtgagcatgagcttcccgctgtcttcaccccgcttctcgggcagtgccttttcatccgtcttccagagcattaacccctcgaccttcaagaagcagaagaaagtcccttcagccctgacagaggtggctgcctctggagagggctctgccatcagtggctatctcagccggtgtaagaggggcaagcggcactggaagaagctctggtttgtcatcaaaggcaaagttctctacacctacatggccagtgaggacaaagtggccttggagagtatgcctctgctaggcttcaccattgctccagaaaaggaagagggcagcagtgaagtaggacctatttttcacctttaccacaagaaaaccctattttatagcttcaaagcagaagataccaattcagctcagaggtggatcgaggccatggaagatgcgagtgtgttatag
Sequence Length
1623
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,238 Da
NCBI Official Full Name
Homo sapiens FYVE, RhoGEF and PH domain containing 5, mRNA
NCBI Official Synonym Full Names
FYVE, RhoGEF and PH domain containing 5
NCBI Official Symbol
FGD5
NCBI Official Synonym Symbols
ZFYVE23
NCBI Protein Information
FYVE, RhoGEF and PH domain-containing protein 5
UniProt Protein Name
FYVE, RhoGEF and PH domain-containing protein 5
Protein Family
UniProt Gene Name
FGD5
UniProt Synonym Gene Names
ZFYVE23
UniProt Entry Name
FGD5_HUMAN
Uniprot Description
FGD5: Activates CDC42, a member of the Ras-like family of Rho- and Rac proteins, by exchanging bound GDP for free GTP. Mediates VEGF-induced CDC42 activation. May regulate proangiogenic action of VEGF in vascular endothelial cells, including network formation, directional movement and proliferation. May play a role in regulating the actin cytoskeleton and cell shape. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: GEFs; GEFs, Rac/Rho
Chromosomal Location of Human Ortholog: 3p25.1
Cellular Component: cytoplasm; Golgi apparatus; lamellipodium; ruffle
Molecular Function: guanyl-nucleotide exchange factor activity; protein binding; small GTPase binding
Biological Process: actin cytoskeleton organization and biogenesis; cytoskeleton organization and biogenesis; filopodium formation; regulation of cell shape; regulation of GTPase activity
Research Articles on FGD5
Similar Products
Product Notes
The FGD5 fgd5 (Catalog #AAA1267302) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagggcct tggatgacat ggaccatgaa ggcagagaca cattggcccg ggaggagctg aggcagggcc tgagtgaact cccagccatc cacgaccttc atcaaggcat cctggaggag ctggaggaaa ggctgtcaaa ttgggagagc cagcagaagg tagctgacgt cttccttgcc cgggagcagg ggtttgatca ccacgccact cacatcctgc agttcgacag gtacctaggt ctgctcagtg agaattgcct ccactctccc cggctggcag ctgctgtccg tgaatttgag cagagtgtac aaggaggcag ccagactgcg aagcatcggc tgctgcgggt ggttcaacgc ctcttccagt accaagtgct cctcacagac tatttaaaca acctttgtcc ggactccgcc gagtacgaca acacacaggg tgcactgagc ctcatctcca aagtcacaga ccgtgccaac gacagcatgg agcaagggga aaacctgcag aagctggtcc acattgagca cagcgtccgg ggccaagggg atctcctcca gccaggaagg gagtttctga aggaagggac gctgatgaaa gtaacaggga aaaacagacg gccccggcac ctatttctga tgaacgatgt gctcctgtac acctatcccc agaaggatgg gaagtaccgg ctgaagaaca cattggctgt ggccaacatg aaggtcagcc gccctgtgat ggagaaagtg ccctacgctc taaagattga gacttccgag tcctgcctga tgctgtctgc gagctcctgt gcagagaggg acgagtggta tggctgtctg agcagagccc tccctgagga ctacaaggcc caggcgctgg ctgcattcca ccatagcgtg gagatacgag agaggctggg ggttagcctt ggggagaggc cccccaccct ggtgcctgtc acacacgtca tgatgtgcat gaactgcggc tgcgacttct ccctcaccct gcggcgtcat cactgtcacg cctgtggcaa gatcgtgtgc cggaactgtt cgcggaacaa gtacccgctg aagtacctga aggacaggat ggccaaggtc tgcgacggct gcttcgggga gctgaagaag cggggcaggg ctgtcccggg cctgatgaga gagcggcctg tgagcatgag cttcccgctg tcttcacccc gcttctcggg cagtgccttt tcatccgtct tccagagcat taacccctcg accttcaaga agcagaagaa agtcccttca gccctgacag aggtggctgc ctctggagag ggctctgcca tcagtggcta tctcagccgg tgtaagaggg gcaagcggca ctggaagaag ctctggtttg tcatcaaagg caaagttctc tacacctaca tggccagtga ggacaaagtg gccttggaga gtatgcctct gctaggcttc accattgctc cagaaaagga agagggcagc agtgaagtag gacctatttt tcacctttac cacaagaaaa ccctatttta tagcttcaaa gcagaagata ccaattcagc tcagaggtgg atcgaggcca tggaagatgc gagtgtgtta tag. It is sometimes possible for the material contained within the vial of "FGD5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
