Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXW7 cdna clone

FBXW7 cDNA Clone

Gene Names
FBXW7; AGO; CDC4; FBW6; FBW7; hAgo; FBX30; FBXW6; SEL10; hCdc4; FBXO30; SEL-10
Synonyms
FBXW7; FBXW7 cDNA Clone; FBXW7 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatcaggaactgctctctgtgggcagcaaaagacgacgaactggaggctctctgagaggtaacccttcctcaagccaggtagatgaagaacagatgaatcgtgtggtagaggaggaacagcaacagcaactcagacaacaagaggaggagcacactgcaaggaatggtgaagttgttggagtagaacctagacctggaggccaaaatgattcccagcaaggacagttggaagaaaacaataatagatttatttcggtagatgaggactcctcaggaaaccaagaagaacaagaggaagatgaagaacatgctggtgaacaagatgaggaggatgaggaggaggaggagatggaccaggagagtgacgattttgatcagtctgatgatagtagcagagaagatgaacatacacatactaacagtgtcacgaactccagtagtattgtggacctgcccgttcaccaactctcctccccattctatacaaaaacaacaaaaatgaaaagaaagttggaccatggttctgaggtccgctctttttctttgggaaagaaaccatgcaaagtctcagaatatacaagtaccactgggcttgtaccatgttcagcaacaccaacaacttttggggacctcagagcagccaatggccaagggcaacaacgacgccgaattacatctgtccagccacctacaggcctccaggaatggctaaaaatgtttcagagctggagtggaccagagaaattgcttgctttagatgaactcattgatagttgtgaaccaacacaagtaaaacatatgatgcaagtgatagaaccccagtttcaacgagacttcatttcattgctccctaaagagttggcactctatgtgctttcattcctggaacccaaagacctgctacaagcagctcagacatgtcgctactggagaattttggctgaagacaaccttctctggagagagaaatgcaaagaagaggggattgatgaaccattgcacatcaagagaagaaaagtaataaaaccaggtttcatacacagtccatggaaaagtgcatacatcagacagcacagaattgatactaactggaggcgaggagaactcaaatctcctaaggtgctgaaaggacatgatgatcatgtgatcacatgcttacagttttgtggtaaccgaatagttagtggttctgatgacaacactttaaaagtttggtcagcagtcacaggcaaatgtctgagaacattagtgggacatacaggtggagtatggtcatcacaaatgagagacaacatcatcattagtggatctacagatcggacactcaaagtgtggaatgcagagactggagaatgtatacacaccttatatgggcatacttccactgtgcgttgtatgcatcttcatgaaaaaagagttgttagcggttctcgagatgccactcttagggtttgggatattgagacaggccagtgtttacatgttttgatgggtcatgttgcagcagtccgctgtgttcaatatgatggcaggagggttgttagtggagcatatgattttatggtaaaggtgtgggatccagagactgaaacctgtctacacacgttgcaggggcatactaatagagtctattcattacagtttgatggtatccatgtggtgagtggatctcttgatacatcaatccgtgtttgggatgtggagacagggaattgcattcacacgttaacagggcaccagtcgttaacaagtggaatggaactcaaagacaatattcttgtctctgggaatgcagattctacagttaaaatctgggatatcaaaacaggacagtgtttacaaacattgcaaggtcccaacaagcatcagagtgctgtgacctgtttacagttcaacaagaactttgtaattaccagctcagatgatggaactgtaaaactatgggacttgaaaacgggtgaatttattcgaaacctagtcacattggagagtggggggagtgggggagttgtgtggcggatcagagcctcaaacacaaagctggtgtgtgcagttgggagtcggaatgggactgaagaaaccaagctgctggtgctggactttgatgtggacatgaagtga
Sequence Length
2124
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,120 Da
NCBI Official Full Name
Homo sapiens F-box and WD repeat domain containing 7, mRNA
NCBI Official Synonym Full Names
F-box and WD repeat domain containing 7
NCBI Official Symbol
FBXW7
NCBI Official Synonym Symbols
AGO; CDC4; FBW6; FBW7; hAgo; FBX30; FBXW6; SEL10; hCdc4; FBXO30; SEL-10
NCBI Protein Information
F-box/WD repeat-containing protein 7
UniProt Protein Name
F-box/WD repeat-containing protein 7
UniProt Gene Name
FBXW7
UniProt Synonym Gene Names
hAgo
UniProt Entry Name
FBXW7_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]

Uniprot Description

FBXW7: a substrate recognition component of a SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins including MYC, cyclin E, NOTCH1-released notch intracellular domain (NICD), JUN, and probably PSEN1. Recognizes and binds to phosphorylated target proteins. Other components of the SCF(FBXW7) complex are sCUL1, RBX1, and SKP1A. Defects in FBXW7 may be a cause of breast cancer. The homolog of Cdc4, one of the yeast genes that regulate sister chromatid cohesion. Down-regulation or disruption of FBXW7 resulted in abnormal sister chromatid cohesion in human cells. Four alternatively spliced isoforms have been described.

Protein type: Motility/polarity/chemotaxis; Nucleolus; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 4q31.3

Cellular Component: cytoplasm; cytosol; nucleoplasm; SCF ubiquitin ligase complex

Molecular Function: cyclin binding; identical protein binding; phosphothreonine binding; protein binding; protein binding, bridging; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: lipid homeostasis; negative regulation of DNA endoreduplication; negative regulation of Notch signaling pathway; positive regulation of epidermal growth factor receptor activity; positive regulation of protein ubiquitination; positive regulation of ubiquitin-protein ligase activity; protein polyubiquitination; protein stabilization; protein ubiquitination; regulation of protein localization; SCF-dependent proteasomal ubiquitin-dependent protein catabolic process; sister chromatid cohesion; vasculature development

Research Articles on FBXW7

Similar Products

Product Notes

The FBXW7 fbxw7 (Catalog #AAA1266040) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatcagg aactgctctc tgtgggcagc aaaagacgac gaactggagg ctctctgaga ggtaaccctt cctcaagcca ggtagatgaa gaacagatga atcgtgtggt agaggaggaa cagcaacagc aactcagaca acaagaggag gagcacactg caaggaatgg tgaagttgtt ggagtagaac ctagacctgg aggccaaaat gattcccagc aaggacagtt ggaagaaaac aataatagat ttatttcggt agatgaggac tcctcaggaa accaagaaga acaagaggaa gatgaagaac atgctggtga acaagatgag gaggatgagg aggaggagga gatggaccag gagagtgacg attttgatca gtctgatgat agtagcagag aagatgaaca tacacatact aacagtgtca cgaactccag tagtattgtg gacctgcccg ttcaccaact ctcctcccca ttctatacaa aaacaacaaa aatgaaaaga aagttggacc atggttctga ggtccgctct ttttctttgg gaaagaaacc atgcaaagtc tcagaatata caagtaccac tgggcttgta ccatgttcag caacaccaac aacttttggg gacctcagag cagccaatgg ccaagggcaa caacgacgcc gaattacatc tgtccagcca cctacaggcc tccaggaatg gctaaaaatg tttcagagct ggagtggacc agagaaattg cttgctttag atgaactcat tgatagttgt gaaccaacac aagtaaaaca tatgatgcaa gtgatagaac cccagtttca acgagacttc atttcattgc tccctaaaga gttggcactc tatgtgcttt cattcctgga acccaaagac ctgctacaag cagctcagac atgtcgctac tggagaattt tggctgaaga caaccttctc tggagagaga aatgcaaaga agaggggatt gatgaaccat tgcacatcaa gagaagaaaa gtaataaaac caggtttcat acacagtcca tggaaaagtg catacatcag acagcacaga attgatacta actggaggcg aggagaactc aaatctccta aggtgctgaa aggacatgat gatcatgtga tcacatgctt acagttttgt ggtaaccgaa tagttagtgg ttctgatgac aacactttaa aagtttggtc agcagtcaca ggcaaatgtc tgagaacatt agtgggacat acaggtggag tatggtcatc acaaatgaga gacaacatca tcattagtgg atctacagat cggacactca aagtgtggaa tgcagagact ggagaatgta tacacacctt atatgggcat acttccactg tgcgttgtat gcatcttcat gaaaaaagag ttgttagcgg ttctcgagat gccactctta gggtttggga tattgagaca ggccagtgtt tacatgtttt gatgggtcat gttgcagcag tccgctgtgt tcaatatgat ggcaggaggg ttgttagtgg agcatatgat tttatggtaa aggtgtggga tccagagact gaaacctgtc tacacacgtt gcaggggcat actaatagag tctattcatt acagtttgat ggtatccatg tggtgagtgg atctcttgat acatcaatcc gtgtttggga tgtggagaca gggaattgca ttcacacgtt aacagggcac cagtcgttaa caagtggaat ggaactcaaa gacaatattc ttgtctctgg gaatgcagat tctacagtta aaatctggga tatcaaaaca ggacagtgtt tacaaacatt gcaaggtccc aacaagcatc agagtgctgt gacctgttta cagttcaaca agaactttgt aattaccagc tcagatgatg gaactgtaaa actatgggac ttgaaaacgg gtgaatttat tcgaaaccta gtcacattgg agagtggggg gagtggggga gttgtgtggc ggatcagagc ctcaaacaca aagctggtgt gtgcagttgg gagtcggaat gggactgaag aaaccaagct gctggtgctg gactttgatg tggacatgaa gtga. It is sometimes possible for the material contained within the vial of "FBXW7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.