Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXW11 cdna clone

FBXW11 cDNA Clone

Gene Names
FBXW11; Hos; BTRC2; FBW1B; Fbw11; BTRCP2; FBXW1B
Synonyms
FBXW11; FBXW11 cDNA Clone; FBXW11 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcccgactcggtgattgaggacaagaccatcgagctcatgaacacttcagttatggaagatcaaaatgaagatgagtccccaaagaaaaatactctttggcagataagtaatggaacatcatctgtgatcgtctccagaaagaggccatcagaaggaaactatcaaaaagaaaaagacttgtgtattaaatattttgaccagtggtctgaatcagatcaagtggaatttgtggaacatcttatttcacgaatgtgtcattatcagcatggacatattaactcttacctgaagcccatgttgcagcgggactttattaccgctttaccagagcaaggcttagatcacatagcagaaaacattctttcgtacctggatgccaggtctctgtgtgcagcagagctggtatgtaaagaatggcagcgagtgatctcagaaggaatgctttggaagaagctgattgaacgaatggtacgcactgatcccctatggaaaggactttcagaaagaagagggtgggatcagtacctgtttaaaaacagacccacagatggccctccaaattcattttataggtcattatacccaaagattatccaggatatagagactatagaatctaactggcggtgtggacgacacaacttgcagaggattcagtgccgctctgaaaatagtaaaggtgtctactgtttacagtacgatgatgaaaaaattatcagtggcctacgagataattctattaagatatgggataaaaccagcctggaatgtttgaaagtgttaacaggacacacaggctctgtcctctgtctgcagtatgatgagcgtgtcattgtaactggctcttcagattctacggtgagagtgtgggatgtgaacacgggtgaagttcttaacacattgatccaccacaatgaggctgtattgcacttacgcttcagcaatggactgatggtgacctgttccaaggaccgctccattgctgtgtgggacatggcttctgcgaccgacatcactttacgccgtgtcctggttggccaccgggctgccgtcaatgtagtagactttgacgacaagtacatcgtgtctgcctctggtgacaggaccatcaaagtctggagcacgagcacctgtgaatttgttcgtactctcaatgggcacaagcggggcattgcctgtctccagtacagggatcgcctggttgttagtggatcatcagataataccattaggctctgggatattgaatgtggtgcctgtttaagagtcctagagggacatgaagaattggtccgatgcatccggtttgataacaagaggattgtcagtggggcctatgatgggaaaattaaagtttgggacttgcaagctgctcttgaccctcgagccccagcaagcacattgtgtttgcgcacattggtggaacattctggacgtgtgtttcggctccagtttgatgagtttcagatcatcagcagctcccatgatgacactattttgatttgggatttcttaaatgtgcctcccagtgcccagaatgagacccgttctccctccagaacatacacttacatctctagataa
Sequence Length
1590
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,898 Da
NCBI Official Full Name
Homo sapiens F-box and WD repeat domain containing 11, mRNA
NCBI Official Synonym Full Names
F-box and WD repeat domain containing 11
NCBI Official Symbol
FBXW11
NCBI Official Synonym Symbols
Hos; BTRC2; FBW1B; Fbw11; BTRCP2; FBXW1B
NCBI Protein Information
F-box/WD repeat-containing protein 11
UniProt Protein Name
F-box/WD repeat-containing protein 11
UniProt Gene Name
FBXW11
UniProt Synonym Gene Names
BTRCP2; FBW1B; FBXW1B; KIAA0696; HOS
UniProt Entry Name
FBW1B_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons. [provided by RefSeq, Jul 2008]

Uniprot Description

FBW1B: a substrate-recognition component of the SCF (SKP1-CUL1-F-box protein) ubiquitin ligase complex May participate in Wnt signaling. Three alternatively spliced isoforms have been described.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 5q35.1

Cellular Component: centrosome; cytosol; nucleus; SCF ubiquitin ligase complex

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: G2/M transition of mitotic cell cycle; negative regulation of transcription, DNA-dependent; positive regulation of circadian rhythm; positive regulation of proteolysis; positive regulation of transcription, DNA-dependent; proteasomal ubiquitin-dependent protein catabolic process; protein amino acid dephosphorylation; protein destabilization; protein polyubiquitination; protein ubiquitination; SCF-dependent proteasomal ubiquitin-dependent protein catabolic process; stimulatory C-type lectin receptor signaling pathway; stress-activated MAPK cascade; T cell receptor signaling pathway

Research Articles on FBXW11

Similar Products

Product Notes

The FBXW11 fbxw11 (Catalog #AAA1277150) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcccg actcggtgat tgaggacaag accatcgagc tcatgaacac ttcagttatg gaagatcaaa atgaagatga gtccccaaag aaaaatactc tttggcagat aagtaatgga acatcatctg tgatcgtctc cagaaagagg ccatcagaag gaaactatca aaaagaaaaa gacttgtgta ttaaatattt tgaccagtgg tctgaatcag atcaagtgga atttgtggaa catcttattt cacgaatgtg tcattatcag catggacata ttaactctta cctgaagccc atgttgcagc gggactttat taccgcttta ccagagcaag gcttagatca catagcagaa aacattcttt cgtacctgga tgccaggtct ctgtgtgcag cagagctggt atgtaaagaa tggcagcgag tgatctcaga aggaatgctt tggaagaagc tgattgaacg aatggtacgc actgatcccc tatggaaagg actttcagaa agaagagggt gggatcagta cctgtttaaa aacagaccca cagatggccc tccaaattca ttttataggt cattataccc aaagattatc caggatatag agactataga atctaactgg cggtgtggac gacacaactt gcagaggatt cagtgccgct ctgaaaatag taaaggtgtc tactgtttac agtacgatga tgaaaaaatt atcagtggcc tacgagataa ttctattaag atatgggata aaaccagcct ggaatgtttg aaagtgttaa caggacacac aggctctgtc ctctgtctgc agtatgatga gcgtgtcatt gtaactggct cttcagattc tacggtgaga gtgtgggatg tgaacacggg tgaagttctt aacacattga tccaccacaa tgaggctgta ttgcacttac gcttcagcaa tggactgatg gtgacctgtt ccaaggaccg ctccattgct gtgtgggaca tggcttctgc gaccgacatc actttacgcc gtgtcctggt tggccaccgg gctgccgtca atgtagtaga ctttgacgac aagtacatcg tgtctgcctc tggtgacagg accatcaaag tctggagcac gagcacctgt gaatttgttc gtactctcaa tgggcacaag cggggcattg cctgtctcca gtacagggat cgcctggttg ttagtggatc atcagataat accattaggc tctgggatat tgaatgtggt gcctgtttaa gagtcctaga gggacatgaa gaattggtcc gatgcatccg gtttgataac aagaggattg tcagtggggc ctatgatggg aaaattaaag tttgggactt gcaagctgct cttgaccctc gagccccagc aagcacattg tgtttgcgca cattggtgga acattctgga cgtgtgtttc ggctccagtt tgatgagttt cagatcatca gcagctccca tgatgacact attttgattt gggatttctt aaatgtgcct cccagtgccc agaatgagac ccgttctccc tccagaacat acacttacat ctctagataa. It is sometimes possible for the material contained within the vial of "FBXW11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.