FBXL14 cdna clone

FBXL14 cDNA Clone

Gene Names

FBXL14; Fbl14

Synonyms

FBXL14; FBXL14 cDNA Clone; FBXL14 cdna clone

Ordering
Cat. Num. AAA1268047 For Research Use Only!

Sequence

atggagacccacatctcatgcctgttcccggagctgctggccatgatcttcggctacctggacgtccgggacaaggggcgcgcggcgcaggtgtgcaccgcctggcgggacgccgcctaccacaagtcggtgtggcggggggtggaggccaagctgcacctgcgccgggccaacccgtcgctgttccccagcctgcaggcccggggcatccgccgggtgcagatcctgagcctccgccgcagcctcagctacgtgatccagggcatggccaacatcgagagcctcaacctcagcggctgctacaacctcaccgacaacgggctgggccacgcgtttgtgcaggagatcggctccctgcgcgctctcaacctgagcctctgcaagcagatcactgacagcagcctgggccgcatagcccagtacctcaagggcctggaggtgctggagctgggaggttgcagcaacatcaccaacactggccttctgctcatcgcctggggtctgcagcgcctcaagagccttaacctccgcagctgccgccacctttcggatgtgggcatcgggcacctggccggcatgacgcgcagcgcggcggagggctgcctgggcctggagcagctcacgctacaggactgccagaagctcacagatctttctctaaagcacatctcccgagggctgacgggcttgaggctcctcaacctcagcttctgtgggggaatctcggacgctggcctcctgcacctgtcgcacatgggcagcctgcgcagcctcaacctgcgctcctgtgacaacatcagtgacacgggcatcatgcatctggccatgggcagcctgcgcctctcggggctggatgtttcgttctgtgacaaggtgggagaccagagtctggcttacatagcccaggggctggatggcctcaagtctctctccctctgctcctgccacatcagtgatgatggcatcaaccgcatggtgcggcagatgcacgggctgcgcacgctcaacattggacagtgtgtgcgcatcacggacaagggcctggagctgatcgctgagcacctgagccaactcaccggcatagacctgtacggctgcacccgaatcaccaagcgcggcctggagcgcatcacgcagctgccgtgcctcaaggtactcaacctgggactctggcagatgacggacagtgagaaggaggcacgaggggatttttctccattattcactgtgagaactcggggaagctccagaaggtga

Sequence Length

1257

Vector

pENTR223.1

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

20381418

NCBI GeneID

144699

Molecular Weight

45,886 Da

NCBI Official Full Name

Homo sapiens F-box and leucine-rich repeat protein 14, mRNA

NCBI Official Synonym Full Names

F-box and leucine rich repeat protein 14

NCBI Official Symbol

FBXL14

NCBI Official Synonym Symbols

Fbl14

NCBI Protein Information

F-box/LRR-repeat protein 14

UniProt Protein Name

F-box/LRR-repeat protein 14

UniProt Gene Name

FBXL14

UniProt Synonym Gene Names

FBL14

UniProt Entry Name

FXL14_HUMAN

NCBI Description

Members of the F-box protein family, such as FBXL14, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]

Uniprot Description

FBXL14: Substrate-recognition component of some SCF (SKP1-CUL1- F-box protein)-type E3 ubiquitin-protein ligase complexes. The SCF(FBXL14) complex acts by mediating ubiquitination and subsequent degradation of SNAI1.

Chromosomal Location of Human Ortholog: 12p13.33

Cellular Component: cytoplasm; Golgi apparatus; nucleoplasm

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: protein ubiquitination during ubiquitin-dependent protein catabolic process

Research Articles on FBXL14

1. Data show that Twist1 small interfering RNA prevents hypoxia-induced Fbxl14 down-regulation and SNAIL1 stabilization.

Similar Products

Product Notes

The FBXL14 fbxl14 (Catalog #AAA1268047) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaccc acatctcatg cctgttcccg gagctgctgg ccatgatctt cggctacctg gacgtccggg acaaggggcg cgcggcgcag gtgtgcaccg cctggcggga cgccgcctac cacaagtcgg tgtggcgggg ggtggaggcc aagctgcacc tgcgccgggc caacccgtcg ctgttcccca gcctgcaggc ccggggcatc cgccgggtgc agatcctgag cctccgccgc agcctcagct acgtgatcca gggcatggcc aacatcgaga gcctcaacct cagcggctgc tacaacctca ccgacaacgg gctgggccac gcgtttgtgc aggagatcgg ctccctgcgc gctctcaacc tgagcctctg caagcagatc actgacagca gcctgggccg catagcccag tacctcaagg gcctggaggt gctggagctg ggaggttgca gcaacatcac caacactggc cttctgctca tcgcctgggg tctgcagcgc ctcaagagcc ttaacctccg cagctgccgc cacctttcgg atgtgggcat cgggcacctg gccggcatga cgcgcagcgc ggcggagggc tgcctgggcc tggagcagct cacgctacag gactgccaga agctcacaga tctttctcta aagcacatct cccgagggct gacgggcttg aggctcctca acctcagctt ctgtggggga atctcggacg ctggcctcct gcacctgtcg cacatgggca gcctgcgcag cctcaacctg cgctcctgtg acaacatcag tgacacgggc atcatgcatc tggccatggg cagcctgcgc ctctcggggc tggatgtttc gttctgtgac aaggtgggag accagagtct ggcttacata gcccaggggc tggatggcct caagtctctc tccctctgct cctgccacat cagtgatgat ggcatcaacc gcatggtgcg gcagatgcac gggctgcgca cgctcaacat tggacagtgt gtgcgcatca cggacaaggg cctggagctg atcgctgagc acctgagcca actcaccggc atagacctgt acggctgcac ccgaatcacc aagcgcggcc tggagcgcat cacgcagctg ccgtgcctca aggtactcaa cctgggactc tggcagatga cggacagtga gaaggaggca cgaggggatt tttctccatt attcactgtg agaactcggg gaagctccag aaggtga. It is sometimes possible for the material contained within the vial of "FBXL14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

FBXL14 cdna clone