Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM82A1 cdna clone

FAM82A1 cDNA Clone

Gene Names
RMDN2; RMD2; RMD4; RMD-2; FAM82A; BLOCK18; FAM82A1; PRO34163; PYST9371
Synonyms
FAM82A1; FAM82A1 cDNA Clone; FAM82A1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgggcactgctggaatcagcttgctgctcttgtggtaccacaaggtccgtaaaccagggatagcaatgaagttacctgaatttctttctctgggtaatacatttaattcaataactttgcaagatgaaatacatgatgaccaaggaacaacagtaatctttcaagaaaggcaacttcagatactggagaagttaaacgaattactgacaaatatggaagaactcaaagaggaaatcagatttcttaaagaagctattccaaagctggaggaatatatacaagatgaacttggagggaaaataactgttcataagataagccctcagcacagagcgagaaaaagaagactccccacaattcaaagttcagcaacaagtaatagttcagaggaagcagaaagtgaaggagggtatattacagctaatactgacacagaagaacagagttttccagtccctaaggcatttaacacacgtgtagaggaattaaatttagatgtccttcttcagaaggtagatcatttacgtatgagtgagtctggcaagtcggagagttttgaactacttcgtgaccacaaagaaaagtttagagatgaaatagagtttatgtggcgatttgctcgtgcttatggagacatgtatgaactatctacaaacacacaagaaaagaaacattatgctaatattggaaaaactttaagtgaaagagctattaatagagcacccatgaatggacattgtcatctgtggtatgcagttttgtgtggctatgtatctgagtttgagggtttacaaaacaaaatcaactatgggcacctcttcaaggaacatctagatatagcaatcaaacttttaccagaggaaccctttctatattacctcaaagggagatactgctatactgtctcaaaactgagctggattgagaaaaaaatggctgctactctgtttggaaaaataccatcttcaactgtacaagaagctttacacaatttccttaaggctgaagaactatgccctggttattctaatcccaattacatgtacttagcaaagtgttatactgatcttgaggaaaaccagaatgctttgaagttctgtaatttggctttattgcttcctactgttaccaaagaggataaagaggcacagaaagagatgcaaaaaataatgacttccttgaagaggtaa
Sequence Length
1194
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,961 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 82, member A1, mRNA
NCBI Official Synonym Full Names
regulator of microtubule dynamics 2
NCBI Official Symbol
RMDN2
NCBI Official Synonym Symbols
RMD2; RMD4; RMD-2; FAM82A; BLOCK18; FAM82A1; PRO34163; PYST9371
NCBI Protein Information
regulator of microtubule dynamics protein 2
UniProt Protein Name
Regulator of microtubule dynamics protein 2
UniProt Gene Name
RMDN2
UniProt Synonym Gene Names
FAM82A; FAM82A1; RMD-2; hRMD-2
UniProt Entry Name
RMD2_HUMAN

Uniprot Description

FAM82A1: Belongs to the FAM82/RMD family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 2p22.2

Cellular Component: cytoplasm

Molecular Function: protein binding

Research Articles on FAM82A1

Similar Products

Product Notes

The FAM82A1 rmdn2 (Catalog #AAA1275178) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgggca ctgctggaat cagcttgctg ctcttgtggt accacaaggt ccgtaaacca gggatagcaa tgaagttacc tgaatttctt tctctgggta atacatttaa ttcaataact ttgcaagatg aaatacatga tgaccaagga acaacagtaa tctttcaaga aaggcaactt cagatactgg agaagttaaa cgaattactg acaaatatgg aagaactcaa agaggaaatc agatttctta aagaagctat tccaaagctg gaggaatata tacaagatga acttggaggg aaaataactg ttcataagat aagccctcag cacagagcga gaaaaagaag actccccaca attcaaagtt cagcaacaag taatagttca gaggaagcag aaagtgaagg agggtatatt acagctaata ctgacacaga agaacagagt tttccagtcc ctaaggcatt taacacacgt gtagaggaat taaatttaga tgtccttctt cagaaggtag atcatttacg tatgagtgag tctggcaagt cggagagttt tgaactactt cgtgaccaca aagaaaagtt tagagatgaa atagagttta tgtggcgatt tgctcgtgct tatggagaca tgtatgaact atctacaaac acacaagaaa agaaacatta tgctaatatt ggaaaaactt taagtgaaag agctattaat agagcaccca tgaatggaca ttgtcatctg tggtatgcag ttttgtgtgg ctatgtatct gagtttgagg gtttacaaaa caaaatcaac tatgggcacc tcttcaagga acatctagat atagcaatca aacttttacc agaggaaccc tttctatatt acctcaaagg gagatactgc tatactgtct caaaactgag ctggattgag aaaaaaatgg ctgctactct gtttggaaaa ataccatctt caactgtaca agaagcttta cacaatttcc ttaaggctga agaactatgc cctggttatt ctaatcccaa ttacatgtac ttagcaaagt gttatactga tcttgaggaa aaccagaatg ctttgaagtt ctgtaatttg gctttattgc ttcctactgt taccaaagag gataaagagg cacagaaaga gatgcaaaaa ataatgactt ccttgaagag gtaa. It is sometimes possible for the material contained within the vial of "FAM82A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.