Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAIM2 cdna clone

FAIM2 cDNA Clone

Gene Names
FAIM2; LFG; LFG2; NGP35; NMP35; TMBIM2
Synonyms
FAIM2; FAIM2 cDNA Clone; FAIM2 cdna clone
Ordering
For Research Use Only!
Sequence
atgacccagggaaagctctccgtggctaacaaggcccctgggaccgaggggcagcagcaggtgcatggcgagaagaaggaggctccagcagtgccctcagccccaccctcctatgaggaagccacctctggggaggggatgaaggcaggggccttccccccagcccccacagcggtgcctctccaccctagctgggcctatgtggaccccagcagcagctccagctatgacaacggtttccccaccggagaccatgagctcttcaccactttcagctgggatgaccagaaagttcgtcgagtctttgtcagaaaggtctacaccatcctgctgattcagctgctggtgaccttggctgtcgtggctctctttactttctgtgaccctgtcaaggactatgtccaggccaacccaggctggtactgggcatcctatgctgtgttctttgcaacctacctgaccctggcttgctgttctggacccaggaggcatttcccctggaacctgattctcctgaccgtctttaccctgtccatggcctacctcactgggatgctgtccagctactacaacaccacctccgtgctgctgtgcctgggcatcacggcccttgtctgcctctcagtcaccgtcttcagcttccagaccaagttcgacttcacctcctgccagggcgtgctcttcgtgcttctcatgactcttttcttcagcggactcatcctggccatcctcctacccttccaatatgtgccctggctccatgcagtttatgcagcactgggagcgggtgtatttacattgttcctggcacttgacacccagttgctgatgggtaaccgacgccactcgctgagccctgaggagtatatttttggagccctcaacatttacctagacatcatctatatcttcaccttcttcctgcagctttttggcactaaccgagaatga
Sequence Length
951
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,448 Da
NCBI Official Full Name
Homo sapiens Fas apoptotic inhibitory molecule 2, mRNA
NCBI Official Synonym Full Names
Fas apoptotic inhibitory molecule 2
NCBI Official Symbol
FAIM2
NCBI Official Synonym Symbols
LFG; LFG2; NGP35; NMP35; TMBIM2
NCBI Protein Information
protein lifeguard 2
UniProt Protein Name
Protein lifeguard 2
Protein Family
UniProt Gene Name
FAIM2
UniProt Synonym Gene Names
KIAA0950; LFG; LFG2; NMP35; TMBIM2
UniProt Entry Name
LFG2_HUMAN

Uniprot Description

FAIM2: Antiapoptotic protein which protects cells uniquely from Fas-induced apoptosis. Regulates Fas-mediated apoptosis in neurons by interfering with caspase-8 activation. May play a role in cerebellar development by affecting cerebellar size, internal granular layer (IGL) thickness, and Purkinje cell (PC) development. Belongs to the BI1 family. LFG subfamily.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Apoptosis

Chromosomal Location of Human Ortholog: 12q13

Cellular Component: lipid raft

Biological Process: cerebellar granular layer development; cerebellar Purkinje cell differentiation; cerebellar Purkinje cell layer development; cerebellum development; regulation of neuron apoptosis

Research Articles on FAIM2

Similar Products

Product Notes

The FAIM2 faim2 (Catalog #AAA1267187) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacccagg gaaagctctc cgtggctaac aaggcccctg ggaccgaggg gcagcagcag gtgcatggcg agaagaagga ggctccagca gtgccctcag ccccaccctc ctatgaggaa gccacctctg gggaggggat gaaggcaggg gccttccccc cagcccccac agcggtgcct ctccacccta gctgggccta tgtggacccc agcagcagct ccagctatga caacggtttc cccaccggag accatgagct cttcaccact ttcagctggg atgaccagaa agttcgtcga gtctttgtca gaaaggtcta caccatcctg ctgattcagc tgctggtgac cttggctgtc gtggctctct ttactttctg tgaccctgtc aaggactatg tccaggccaa cccaggctgg tactgggcat cctatgctgt gttctttgca acctacctga ccctggcttg ctgttctgga cccaggaggc atttcccctg gaacctgatt ctcctgaccg tctttaccct gtccatggcc tacctcactg ggatgctgtc cagctactac aacaccacct ccgtgctgct gtgcctgggc atcacggccc ttgtctgcct ctcagtcacc gtcttcagct tccagaccaa gttcgacttc acctcctgcc agggcgtgct cttcgtgctt ctcatgactc ttttcttcag cggactcatc ctggccatcc tcctaccctt ccaatatgtg ccctggctcc atgcagttta tgcagcactg ggagcgggtg tatttacatt gttcctggca cttgacaccc agttgctgat gggtaaccga cgccactcgc tgagccctga ggagtatatt tttggagccc tcaacattta cctagacatc atctatatct tcaccttctt cctgcagctt tttggcacta accgagaatg a. It is sometimes possible for the material contained within the vial of "FAIM2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.