Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FABP3 cdna clone

FABP3 cDNA Clone

Gene Names
FABP3; MDGI; FABP11; H-FABP; M-FABP; O-FABP
Synonyms
FABP3; FABP3 cDNA Clone; FABP3 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggacgctttcctgggcacctggaagctagtggacagcaagaatttcgatgactacatgaagtcactcggtgtgggttttgctaccaggcaggtggccagcatgaccaagcctaccacaatcatcgaaaagaatggggacattctcaccctaaaaacacacagcaccttcaagaacacagagatcagctttaagttgggggtggagttcgatgagacaacagcagatgacaggaaggtcaagtccattgtgacactggatggagggaaacttgttcacctgcagaaatgggacgggcaagagaccacacttgtgcgggagctaattgatggaaaactcatcctgacactcacccacggcactgcagtttgcactcgcacttatgagaaagaggcatga
Sequence Length
402
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,858 Da
NCBI Official Full Name
Homo sapiens fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor), mRNA
NCBI Official Synonym Full Names
fatty acid binding protein 3
NCBI Official Symbol
FABP3
NCBI Official Synonym Symbols
MDGI; FABP11; H-FABP; M-FABP; O-FABP
NCBI Protein Information
fatty acid-binding protein, heart
UniProt Protein Name
Fatty acid-binding protein, heart
UniProt Gene Name
FABP3
UniProt Synonym Gene Names
FABP11; MDGI; H-FABP; MDGI; M-FABP
UniProt Entry Name
FABPH_HUMAN

NCBI Description

The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Uniprot Description

FABP3: FABP are thought to play a role in the intracellular transport of long-chain fatty acids and their acyl-CoA esters. Belongs to the calycin superfamily. Fatty-acid binding protein (FABP) family.

Protein type: Lipid-binding

Chromosomal Location of Human Ortholog: 1p33-p32

Cellular Component: cytosol; extracellular space

Molecular Function: cytoskeletal protein binding; protein binding

Biological Process: cholesterol homeostasis; negative regulation of cell proliferation; phospholipid homeostasis; regulation of fatty acid oxidation; triacylglycerol catabolic process

Research Articles on FABP3

Similar Products

Product Notes

The FABP3 fabp3 (Catalog #AAA1274472) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggacg ctttcctggg cacctggaag ctagtggaca gcaagaattt cgatgactac atgaagtcac tcggtgtggg ttttgctacc aggcaggtgg ccagcatgac caagcctacc acaatcatcg aaaagaatgg ggacattctc accctaaaaa cacacagcac cttcaagaac acagagatca gctttaagtt gggggtggag ttcgatgaga caacagcaga tgacaggaag gtcaagtcca ttgtgacact ggatggaggg aaacttgttc acctgcagaa atgggacggg caagagacca cacttgtgcg ggagctaatt gatggaaaac tcatcctgac actcacccac ggcactgcag tttgcactcg cacttatgag aaagaggcat ga. It is sometimes possible for the material contained within the vial of "FABP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.