Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

F11R cdna clone

F11R cDNA Clone

Gene Names
F11R; JAM; KAT; JAM1; JAMA; JCAM; CD321; PAM-1
Synonyms
F11R; F11R cDNA Clone; F11R cdna clone
Ordering
For Research Use Only!
Sequence
atggggacaaaggcgcaagtcgagaggaaactgttgtgcctcttcatattggcgatcctgttgtgctccctggcattgggcagtgttacagtgcactcttctgaacctgaagtcagaattcctgagaataatcctgtgaagttgtcctgtgcctactcgggcttttcttctccccgtgtggagtggaagtttgaccaaggagacaccaccagactcgtttgctataataacaagatcacagcttcctatgaggaccgggtgaccttcttgccaactggtatcaccttcaagtccgtgacacgggaagacactgggacatacacttgtatggtctctgaggaaggcggcaacagctatggggaggtcaaggtcaagctcatcgtgcttgtgcctccatccaagcctacagttaacatcccctcctctgccaccattgggaaccgggcagtgctgacatgctcagaacaagatggttccccaccttctgaatacacctggttcaaagatgggatagtgatgcctacgaatcccaaaagcacccgtgccttcagcaactcttcctatgtcctgaatcccacaacaggagagctggtctttgatcccctgtcagcctctgatactggagaatacagctgtgaggcacggaatgggtatgggacacccatgacttcaaatgctgtgcgcatggaagctgtggagcggaatgtgggggtcatcgtggcagccgtccttgtaaccctgattctcctgggaatcttggtttttggcatctggtttgcctatagccgaggccactttgacagaacaaagaaagggacttcgagtaagaaggtgatttacagccagcctagtgcccgaagtgaaggagaattcaaacagacctcgtcattcctggtgtga
Sequence Length
900
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,208 Da
NCBI Official Full Name
Homo sapiens F11 receptor, mRNA
NCBI Official Synonym Full Names
F11 receptor
NCBI Official Symbol
F11R
NCBI Official Synonym Symbols
JAM; KAT; JAM1; JAMA; JCAM; CD321; PAM-1
NCBI Protein Information
junctional adhesion molecule A
UniProt Protein Name
Junctional adhesion molecule A
UniProt Gene Name
F11R
UniProt Synonym Gene Names
JAM1; JCAM; JAM-A; JAM-1; PAM-1
UniProt Entry Name
JAM1_HUMAN

NCBI Description

Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is an important regulator of tight junction assembly in epithelia. In addition, the encoded protein can act as (1) a receptor for reovirus, (2) a ligand for the integrin LFA1, involved in leukocyte transmigration, and (3) a platelet receptor. Multiple 5' alternatively spliced variants, encoding the same protein, have been identified but their biological validity has not been established. [provided by RefSeq, Jul 2008]

Uniprot Description

JAM-A: Seems to play a role in epithelial tight junction formation. Appears early in primordial forms of cell junctions and recruits PARD3. The association of the PARD6-PARD3 complex may prevent the interaction of PARD3 with JAM1, thereby preventing tight junction assembly. Plays a role in regulating monocyte transmigration involved in integrity of epithelial barrier. Involved in platelet activation. In case of orthoreovirus infection, serves as receptor for the virus. Belongs to the immunoglobulin superfamily.

Protein type: Cell adhesion; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q21.2-q21.3

Cellular Component: cell junction; cell-cell adherens junction; intercellular junction; microtubule cytoskeleton; plasma membrane; tight junction

Molecular Function: PDZ domain binding; protein binding

Biological Process: actomyosin structure organization and biogenesis; extracellular matrix organization and biogenesis; inflammatory response; intestinal absorption; leukocyte migration; positive regulation of GTPase activity; transforming growth factor beta receptor signaling pathway

Research Articles on F11R

Similar Products

Product Notes

The F11R f11r (Catalog #AAA1278458) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggacaa aggcgcaagt cgagaggaaa ctgttgtgcc tcttcatatt ggcgatcctg ttgtgctccc tggcattggg cagtgttaca gtgcactctt ctgaacctga agtcagaatt cctgagaata atcctgtgaa gttgtcctgt gcctactcgg gcttttcttc tccccgtgtg gagtggaagt ttgaccaagg agacaccacc agactcgttt gctataataa caagatcaca gcttcctatg aggaccgggt gaccttcttg ccaactggta tcaccttcaa gtccgtgaca cgggaagaca ctgggacata cacttgtatg gtctctgagg aaggcggcaa cagctatggg gaggtcaagg tcaagctcat cgtgcttgtg cctccatcca agcctacagt taacatcccc tcctctgcca ccattgggaa ccgggcagtg ctgacatgct cagaacaaga tggttcccca ccttctgaat acacctggtt caaagatggg atagtgatgc ctacgaatcc caaaagcacc cgtgccttca gcaactcttc ctatgtcctg aatcccacaa caggagagct ggtctttgat cccctgtcag cctctgatac tggagaatac agctgtgagg cacggaatgg gtatgggaca cccatgactt caaatgctgt gcgcatggaa gctgtggagc ggaatgtggg ggtcatcgtg gcagccgtcc ttgtaaccct gattctcctg ggaatcttgg tttttggcat ctggtttgcc tatagccgag gccactttga cagaacaaag aaagggactt cgagtaagaa ggtgatttac agccagccta gtgcccgaag tgaaggagaa ttcaaacaga cctcgtcatt cctggtgtga. It is sometimes possible for the material contained within the vial of "F11R, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.