EVL cdna clone
EVL cDNA Clone
Gene Names
EVL; RNB6
Synonyms
EVL; EVL cDNA Clone; EVL cdna clone
Sequence
atgagtgaacagagtatctgccaagcccgggcttccgtgatggtctacgatgacaccagtaagaaatgggtaccaatcaaacctggccagcagggattcagccggatcaacatctaccacaacactgccagcaacaccttcagagtcgttggagtcaagttgcaggatcagcaggttgtgatcaattattcaatcgtgaaagggctgaagtacaatcaggccacgccaaccttccaccagtggcgagatgcccgccaggtctacggcttaaactttgcaagtaaagaagaggcaaccacgttctccaatgcaatgctgtttgccctgaacatcatgaattcccaagaaggaggcccctccagccagcgtcaggtgcagaatggcccctctcctgatgagatggacatccagagaagacaagtgatggagcagcaccagcagcagcgtcaggaatctctagaaagaagaacctcggccacagggcccatcctcccaccaggacatccttcatctgcagccagcgcccccgtctcatgtagtgggcctccaccgccccccccacccccagtcccacctccacccactggggctaccccacctcccccacccccactgccagccggaggagcccaggggtccagccacgacgagagctccatgtcaggactggccgctgccatagctggggccaagctgagaagagtccaacggccagaagacgcatctggaggctccagtcccagtgggacctcaaagtccgatgccaaccgggcaagcagcgggggtggcggaggaggcctcatggaggaaatgaacaaactgctggccaagaggagaaaagcagcctcccagtcagacaagccagccgagaagaaggaagatgaaagccaaatggaagatcctagtacctccccctctccggggacccgagcagccagccagccacctaactcctcagaggctggccggaagccctgggagcggagcaactcggtggagaagcctgtgtcctcgattctgtccagaaccccgtctgtggcaaagagccccgaagctaagagcccccttcagtcgcagcctcactctaggatgaagcctgctgggagcgtgaatgacatggccctggatgccttcgacttggaccggatgaagcaggagatcctagaggaggtggtgagagagctccacaaggtgaaggaggagatcatcgacgccatcaggcaggagctgagtgggatcagcaccacgtaa
Sequence Length
1251
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
41,577 Da
NCBI Official Full Name
Homo sapiens Enah/Vasp-like, mRNA
NCBI Official Synonym Full Names
Enah/Vasp-like
NCBI Official Symbol
EVL
NCBI Official Synonym Symbols
RNB6
NCBI Protein Information
ena/VASP-like protein
UniProt Protein Name
Ena/VASP-like protein
Protein Family
UniProt Gene Name
EVL
UniProt Synonym Gene Names
RNB6
UniProt Entry Name
EVL_HUMAN
Uniprot Description
EVL: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells. EVL enhances actin nucleation and polymerization. Required to transform actin polymerization into active movement for the propulsive force of Listeria monocytogenes. Belongs to the Ena/VASP family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Cytoskeletal; Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 14q32.2
Cellular Component: cytoplasm; cytosol; focal adhesion; lamellipodium; membrane
Molecular Function: profilin binding; protein binding; SH3 domain binding
Biological Process: actin filament organization; actin polymerization and/or depolymerization; axon guidance; positive regulation of stress fiber formation
Research Articles on EVL
Similar Products
Product Notes
The EVL evl (Catalog #AAA1274445) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgaac agagtatctg ccaagcccgg gcttccgtga tggtctacga tgacaccagt aagaaatggg taccaatcaa acctggccag cagggattca gccggatcaa catctaccac aacactgcca gcaacacctt cagagtcgtt ggagtcaagt tgcaggatca gcaggttgtg atcaattatt caatcgtgaa agggctgaag tacaatcagg ccacgccaac cttccaccag tggcgagatg cccgccaggt ctacggctta aactttgcaa gtaaagaaga ggcaaccacg ttctccaatg caatgctgtt tgccctgaac atcatgaatt cccaagaagg aggcccctcc agccagcgtc aggtgcagaa tggcccctct cctgatgaga tggacatcca gagaagacaa gtgatggagc agcaccagca gcagcgtcag gaatctctag aaagaagaac ctcggccaca gggcccatcc tcccaccagg acatccttca tctgcagcca gcgcccccgt ctcatgtagt gggcctccac cgcccccccc acccccagtc ccacctccac ccactggggc taccccacct cccccacccc cactgccagc cggaggagcc caggggtcca gccacgacga gagctccatg tcaggactgg ccgctgccat agctggggcc aagctgagaa gagtccaacg gccagaagac gcatctggag gctccagtcc cagtgggacc tcaaagtccg atgccaaccg ggcaagcagc gggggtggcg gaggaggcct catggaggaa atgaacaaac tgctggccaa gaggagaaaa gcagcctccc agtcagacaa gccagccgag aagaaggaag atgaaagcca aatggaagat cctagtacct ccccctctcc ggggacccga gcagccagcc agccacctaa ctcctcagag gctggccgga agccctggga gcggagcaac tcggtggaga agcctgtgtc ctcgattctg tccagaaccc cgtctgtggc aaagagcccc gaagctaaga gcccccttca gtcgcagcct cactctagga tgaagcctgc tgggagcgtg aatgacatgg ccctggatgc cttcgacttg gaccggatga agcaggagat cctagaggag gtggtgagag agctccacaa ggtgaaggag gagatcatcg acgccatcag gcaggagctg agtgggatca gcaccacgta a. It is sometimes possible for the material contained within the vial of "EVL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
