Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ETF1 cdna clone

ETF1 cDNA Clone

Gene Names
ETF1; ERF; RF1; ERF1; TB3-1; D5S1995; SUP45L1
Synonyms
ETF1; ETF1 cDNA Clone; ETF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatatcattgatcattcctcccaaagaccagatttcacgagtggcaaaaatgttagcggatgagtttggaactgcatctaacattaagtcacgagtaaaccgcctttcagtcctgggagccattacatctgtacaacaaagactcaaactttataacaaagtacctccaaatggtctggttgtatactgtggaacaattgtaacagaagaaggaaaggaaaagaaagtcaacattgactttgaacctttcaaaccaattaatacgtcattgtatttgtgtgacaacaaattccatacagaggctcttacagcactactttcagatgatagcaagtttggattcattgtaatagatggtagtggtgcactttttggcacactccaaggaaacacaagagaagtcctgcacaaattcactgtggatctcccaaagaaacacggtagaggaggtcagtcagccttgcgttttgcccgtttaagaatggaaaagcgacataactatgttcggaaagtagcagagactgctgtgcagctgtttatttctggggacaaagtgaatgtggctggtctagttttagctggatccgctgactttaaaactgaactaagtcaatctgatatgtttgatcagaggttacaatcaaaagttttaaaattagttgatatatcctatggtggtgaaaatggattcaaccaagctattgagttatctactgaagtcctctccaacgtgaaattcattcaagagaagaaattaataggacgatactttgatgaaatcagccaggacacgggcaagtactgttttggcgttgaagatacactaaaggctttggaaatgggagctgtagaaattctaatagtctatgaaaatctggatataatgagatatgttcttcattgccaaggcacagaagaggagaaaattctctatctaactccagagcaagaaaaggataaatctcatttcacagacaaagagaccggacaggaacatgagcttatcgagagcatgcccctgttggaatggtttgctaacaactataaaaaatttggagctacgttggaaattgtcacagataaatcacaagaagggtctcagtttgtgaaaggatttggtggaattggaggtatcttgcggtaccgagtagatttccagggaatggaataccaaggaggagacgatgaattttttgaccttgatgactactag
Sequence Length
1215
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,463 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation termination factor 1, mRNA
NCBI Official Synonym Full Names
eukaryotic translation termination factor 1
NCBI Official Symbol
ETF1
NCBI Official Synonym Symbols
ERF; RF1; ERF1; TB3-1; D5S1995; SUP45L1
NCBI Protein Information
eukaryotic peptide chain release factor subunit 1
UniProt Protein Name
Eukaryotic peptide chain release factor subunit 1
UniProt Gene Name
ETF1
UniProt Synonym Gene Names
ERF1; RF1; SUP45L1; Eukaryotic release factor 1; eRF1
UniProt Entry Name
ERF1_HUMAN

NCBI Description

This gene encodes a class-1 polypeptide chain release factor. The encoded protein plays an essential role in directing termination of mRNA translation from the termination codons UAA, UAG and UGA. This protein is a component of the SURF complex which promotes degradation of prematurely terminated mRNAs via the mechanism of nonsense-mediated mRNA decay (NMD). Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 6, 7, and X. [provided by RefSeq, Aug 2013]

Uniprot Description

ETF1: Directs the termination of nascent peptide synthesis (translation) in response to the termination codons UAA, UAG and UGA. Component of the transient SURF complex which recruits UPF1 to stalled ribosomes in the context of nonsense-mediated decay (NMD) of mRNAs containing premature stop codons. Belongs to the eukaryotic release factor 1 family.

Chromosomal Location of Human Ortholog: 5q31.1

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: protein binding; ribosome binding; RNA binding; translation release factor activity; translation termination factor activity

Biological Process: mRNA catabolic process, nonsense-mediated decay; protein amino acid methylation; regulation of translational termination; translational termination

Research Articles on ETF1

Similar Products

Product Notes

The ETF1 etf1 (Catalog #AAA1278422) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatatcat tgatcattcc tcccaaagac cagatttcac gagtggcaaa aatgttagcg gatgagtttg gaactgcatc taacattaag tcacgagtaa accgcctttc agtcctggga gccattacat ctgtacaaca aagactcaaa ctttataaca aagtacctcc aaatggtctg gttgtatact gtggaacaat tgtaacagaa gaaggaaagg aaaagaaagt caacattgac tttgaacctt tcaaaccaat taatacgtca ttgtatttgt gtgacaacaa attccataca gaggctctta cagcactact ttcagatgat agcaagtttg gattcattgt aatagatggt agtggtgcac tttttggcac actccaagga aacacaagag aagtcctgca caaattcact gtggatctcc caaagaaaca cggtagagga ggtcagtcag ccttgcgttt tgcccgttta agaatggaaa agcgacataa ctatgttcgg aaagtagcag agactgctgt gcagctgttt atttctgggg acaaagtgaa tgtggctggt ctagttttag ctggatccgc tgactttaaa actgaactaa gtcaatctga tatgtttgat cagaggttac aatcaaaagt tttaaaatta gttgatatat cctatggtgg tgaaaatgga ttcaaccaag ctattgagtt atctactgaa gtcctctcca acgtgaaatt cattcaagag aagaaattaa taggacgata ctttgatgaa atcagccagg acacgggcaa gtactgtttt ggcgttgaag atacactaaa ggctttggaa atgggagctg tagaaattct aatagtctat gaaaatctgg atataatgag atatgttctt cattgccaag gcacagaaga ggagaaaatt ctctatctaa ctccagagca agaaaaggat aaatctcatt tcacagacaa agagaccgga caggaacatg agcttatcga gagcatgccc ctgttggaat ggtttgctaa caactataaa aaatttggag ctacgttgga aattgtcaca gataaatcac aagaagggtc tcagtttgtg aaaggatttg gtggaattgg aggtatcttg cggtaccgag tagatttcca gggaatggaa taccaaggag gagacgatga attttttgac cttgatgact actag. It is sometimes possible for the material contained within the vial of "ETF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.