Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EPC1 cdna clone

EPC1 cDNA Clone

Gene Names
EPC1; Epl1
Synonyms
EPC1; EPC1 cDNA Clone; EPC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtaaactgtcgtttcgggcgcgggcgctagacgcctcgaagccgctgccggttttccgctgtgaggatctgcccgacctgcacgaatacgcctcgataaacagggccgtgccgcagatgcccaccggaatggagaaggaagaggagtcggaacatcatcttcagcgggctatttcagcacagcaggtgtatggcgagaagagggataatatggttataccggtcccagaggcagaaagtaatattgcttactatgagtctatatatcctggggaatttaagatgccaaagcagctcattcacatacagccttttagtttggatgctgaacagcctgattatgatttggattctgaagatgaagtatttgtgaataaactgaaaaagaaaatggacatctgcccattgcaatttgaggagatgattgaccgcctagaaaaaggcagtggtcagcagccagtcagtctgcaggaagccaaactactgctaaaagaagatgatgaactaattagagaagtttatgaatattggattaaaaagagaaaaaactgtcgagggccatctcttattccatcagtaaaacaagagaagcgagatggttccagcacaaatgatccttatgtggcttttagaaggcgtactgaaaaaatgcagactcgaaaaaatcgcaaaaatgatgaagcctcttacgaaaaaatgcttaagctgcgacgagatctaagtcgagctgttactattctagagatgataaaaagaagagaaaaaagtaaaagagagctattgcacttaacactggaaattatggaaaagaggtataatttgggcgactacaatggagagatcatgtctgaggttatggcacagagacagccaatgaaacctacttatgccatccccatcatccctattactaatagcagtcaatttaaacaccaggaagcaatggatgtgaaggagttcaaagttaataagcaagataaagccgatcttatccgaccgaaacggaaatatgaaaagaagcccaaagtcttaccatcgtctgccgctgctactccccaacagacgagtcctgctgcactgccagtcttcaatgctaaagatctgaatcagtatgactttcccagctcagacgaagaacctctctcccaggttttgtctggctcttcggaagctgaggaagacaatgatcctgatggtccttttgctttccgtaggaaagcaggctgtcagtactatgctcctcacttagaccaaactggcaactggccttggactagtcctaaagatggaggattaggggatgtgcgatatagatactgcttaactactctcaccgtaccccaaaggtgtattggatttgcacgaagacgggttgggcgcggtggaagggtcttactggacagagctcattcagactatgacagtgtgtttcaccatctggatttggaaatgctttcctcaccacaacattctccagtcaatcagtttgccaatacctcagaaacaaatacctcggacaaatctttctctaaagacctcagtcagatactagtcaatatcaaatcatgtagatggcggcattttaggcctcggacaccatccctacatgacagtgacaatgatgaactctcctgtagaaaattatataggagtataaaccgaacaggaacagcgcaacctgggacccagacatgcagtacctctacgcaaagtaaaagtagcagtggttcagcacactttgcatttacagccgaacaataccagcaacatcaacagcaactggcactcatgcagaaacagcagcttgcacaaattcagcaacagcaagcaaatagtaattcctccaccaacacatcacagggttttgtttctaagactttggattctgctagtgcacagtttgctgcttctgctttggtgacatcagaacaactgatgggattcaagatgaaggatgatgtggtgcttggaatcggggtgaatggcgtccttccagcctcaggagtatacaagggcttacacctcagtagtactacaccaacagcacttgtacatacaagtccatcaacggcaggttcagctttgttacagccttcaaatattacacagacttcaagttcccacagtgcactgagtcatcaagtaactgctgccaattctgcaacaactcaggttctgattgggaacaacattcgattaactgtaccttcatcagttgccactgtaaactctattgccccaataaatgcacgacatatacctaggactttaagtgttgttccatcatctgccttaaagctggccgctgcagcaaactgtcaagtttccaaggtcccatcttcatcctctgtagattcagttccaagggaaaatcatgaatcagaaaagccagcactgaacaacatagcagacaacacagtagcgatggaggtgacgtag
Sequence Length
2442
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
85,222 Da
NCBI Official Full Name
Homo sapiens enhancer of polycomb homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
enhancer of polycomb homolog 1
NCBI Official Symbol
EPC1
NCBI Official Synonym Symbols
Epl1
NCBI Protein Information
enhancer of polycomb homolog 1
UniProt Protein Name
Enhancer of polycomb homolog 1
Protein Family
UniProt Gene Name
EPC1
UniProt Entry Name
EPC1_HUMAN

NCBI Description

This gene encodes a member of the polycomb group (PcG) family. The encoded protein is a component of the NuA4 histone acetyltransferase complex and can act as both a transcriptional activator and repressor. The encoded protein has been linked to apoptosis, DNA repair, skeletal muscle differentiation, gene silencing, and adult T-cell leukemia/lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

Uniprot Description

EPC1: Component of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage. Belongs to the enhancer of polycomb family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Acetyltransferase; Nuclear envelope

Chromosomal Location of Human Ortholog: 10p11

Cellular Component: NuA4 histone acetyltransferase complex; nuclear membrane; nucleoplasm; nucleus

Molecular Function: histone acetyltransferase activity; protein binding

Biological Process: negative regulation of gene expression, epigenetic; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; transcription, DNA-dependent

Research Articles on EPC1

Similar Products

Product Notes

The EPC1 epc1 (Catalog #AAA1271893) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtaaac tgtcgtttcg ggcgcgggcg ctagacgcct cgaagccgct gccggttttc cgctgtgagg atctgcccga cctgcacgaa tacgcctcga taaacagggc cgtgccgcag atgcccaccg gaatggagaa ggaagaggag tcggaacatc atcttcagcg ggctatttca gcacagcagg tgtatggcga gaagagggat aatatggtta taccggtccc agaggcagaa agtaatattg cttactatga gtctatatat cctggggaat ttaagatgcc aaagcagctc attcacatac agccttttag tttggatgct gaacagcctg attatgattt ggattctgaa gatgaagtat ttgtgaataa actgaaaaag aaaatggaca tctgcccatt gcaatttgag gagatgattg accgcctaga aaaaggcagt ggtcagcagc cagtcagtct gcaggaagcc aaactactgc taaaagaaga tgatgaacta attagagaag tttatgaata ttggattaaa aagagaaaaa actgtcgagg gccatctctt attccatcag taaaacaaga gaagcgagat ggttccagca caaatgatcc ttatgtggct tttagaaggc gtactgaaaa aatgcagact cgaaaaaatc gcaaaaatga tgaagcctct tacgaaaaaa tgcttaagct gcgacgagat ctaagtcgag ctgttactat tctagagatg ataaaaagaa gagaaaaaag taaaagagag ctattgcact taacactgga aattatggaa aagaggtata atttgggcga ctacaatgga gagatcatgt ctgaggttat ggcacagaga cagccaatga aacctactta tgccatcccc atcatcccta ttactaatag cagtcaattt aaacaccagg aagcaatgga tgtgaaggag ttcaaagtta ataagcaaga taaagccgat cttatccgac cgaaacggaa atatgaaaag aagcccaaag tcttaccatc gtctgccgct gctactcccc aacagacgag tcctgctgca ctgccagtct tcaatgctaa agatctgaat cagtatgact ttcccagctc agacgaagaa cctctctccc aggttttgtc tggctcttcg gaagctgagg aagacaatga tcctgatggt ccttttgctt tccgtaggaa agcaggctgt cagtactatg ctcctcactt agaccaaact ggcaactggc cttggactag tcctaaagat ggaggattag gggatgtgcg atatagatac tgcttaacta ctctcaccgt accccaaagg tgtattggat ttgcacgaag acgggttggg cgcggtggaa gggtcttact ggacagagct cattcagact atgacagtgt gtttcaccat ctggatttgg aaatgctttc ctcaccacaa cattctccag tcaatcagtt tgccaatacc tcagaaacaa atacctcgga caaatctttc tctaaagacc tcagtcagat actagtcaat atcaaatcat gtagatggcg gcattttagg cctcggacac catccctaca tgacagtgac aatgatgaac tctcctgtag aaaattatat aggagtataa accgaacagg aacagcgcaa cctgggaccc agacatgcag tacctctacg caaagtaaaa gtagcagtgg ttcagcacac tttgcattta cagccgaaca ataccagcaa catcaacagc aactggcact catgcagaaa cagcagcttg cacaaattca gcaacagcaa gcaaatagta attcctccac caacacatca cagggttttg tttctaagac tttggattct gctagtgcac agtttgctgc ttctgctttg gtgacatcag aacaactgat gggattcaag atgaaggatg atgtggtgct tggaatcggg gtgaatggcg tccttccagc ctcaggagta tacaagggct tacacctcag tagtactaca ccaacagcac ttgtacatac aagtccatca acggcaggtt cagctttgtt acagccttca aatattacac agacttcaag ttcccacagt gcactgagtc atcaagtaac tgctgccaat tctgcaacaa ctcaggttct gattgggaac aacattcgat taactgtacc ttcatcagtt gccactgtaa actctattgc cccaataaat gcacgacata tacctaggac tttaagtgtt gttccatcat ctgccttaaa gctggccgct gcagcaaact gtcaagtttc caaggtccca tcttcatcct ctgtagattc agttccaagg gaaaatcatg aatcagaaaa gccagcactg aacaacatag cagacaacac agtagcgatg gaggtgacgt ag. It is sometimes possible for the material contained within the vial of "EPC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.