EML1 cdna clone
EML1 cDNA Clone
Gene Names
EML1; EMAP; ELP79; EMAPL; HuEMAP
Synonyms
EML1; EML1 cDNA Clone; EML1 cdna clone
Sequence
atggaggacggcttctccagctacagcagcctgtacgacacgtcctcgctgctccagttctgcaacgatgacagcgcttctgctgcaagtagcatggaggtgacagaccgcattgcttcactggagcagagagtccagatgcaagaagacgacatccagctgctcaaatcagctctagctgatgtggttcggcggctgaacattactgaggaacagcaggccgtgcttaacaggaaaggacctaccaaagcaagaccactgatgcagaccctgcccttaagaaccacggtcaacaatggcactgtgttaccaaagaaacctactggctctctaccatccccctccggggtcaggaaagaaactgctgtgccagcaaccaaaagtaacatcaagaggaccagctcttctgaacgagtgtctcctgggggtcgaagggaaagcaatggggattccagaggaaaccggaatcgcacaggctccaccagcagctcttccagtggcaaaaagaacagtgaaagcaaacccaaggagcctgtattcagtgcagaagaaggctatgtaaaaatgtttcttcgtggacgccctgttaccatgtacatgcccaaagatcaagtggattcttacagcttggaagcaaaagtagaacttccaaccaagagactcaagctggaatgggtctatgggtacaggggtcgagactgccgtaacaacctgtacttgcttccgacgggagagaccgtctacttcatcgcatccgtggtggtgttatacaacgtggaggagcaactgcagaggcattacgctggccacaacgatgacgtgaagtgcctagcagttcatcctgatcggatcacgatagcaacaggacaagttgcgggcacatcgaaggatggaaaacaattgcccccacatgtgcgcatctgggattctgtgacattgaatactctccacgtcattggaataggtttttttgaccgagcagtcacctgtattgcattctcaaaatctaatggaggaaccaatctctgtgctgtggatgactccaacgaccatgtgctctctgtatgggactggcagaaagaagaaaaactagcagatgtgaagtgctctaatgaagctgtgtttgctgcggatttccaccccacggacaccaacatcatagttacttgtggaaaatcacatctctacttttggacactagaaggaagctcccttaataagaagcaaggattattcgagaaacaagaaaagccaaagtttgtcctctgtgtgactttctctgaaaacggtgacaccattactggagattcaagtggcaacatcttagtatggggaaaaggtacaaatcgaataagctatgcagttcagggggcccatgagggtggcatttttgcactttgtatgttaagagatggcacactggtgtcgggaggtgggaaagaccgaaagctcatttcttggagcggaaactatcaaaaacttcgtaaaacggagattccagaacagtttggtccaatacggacagtggccgaggggaaaggcgatgtgatcttgattggcacaactcgaaactttgtcctgcagggcactctgtcaggggacttcacacccattactcagggtcacactgatgagctctggggactggccatccatgcctcaaaacctcagttcttgacctgtgggcatgacaagcatgccactctctgggacgctgtgggtcaccgtcccgtctgggacaaaataatagaggatccagctcagtcttctggttttcatccttcagggtctgtggttgcagtcggaacactcactgggaggtggtttgtgtttgacacagaaacaaaagacttggtcaccgttcacacagatggaaacgaacagctctctgtaatgcgatactcaccagatgggaatttcttagccataggctcacatgacaactgcatctatatatatggcgttagtgacaacgggaggaagtacacgcgagtgggcaagtgctcgggtcattccagcttcattactcacctggactggtctgtaaactcacagttcctcgtgtcaaattccggagactacgaaatcctctactgggttccctctgcctgtaagcaagtcgtaagtgtggaaactacaagagacattgaatgggctacctatacctgcactttgggattccatgtttttggagtgtggccagaaggctcggacggaaccgacatcaatgccgtctgtcgggcccatgagaagaaactcctgtcaacaggcgacgactttggcaaagtgcacctcttctcatacccctgctcgcagttcagggctccaagccacatctacggcgggcacagcagccatgtcaccaatgtcgatttcctctgtgaagacagccacctcatctccacgggcgggaaagacacaagcatcatgcagtggcgcgtcatttag
Sequence Length
2448
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
91,985 Da
NCBI Official Full Name
Homo sapiens echinoderm microtubule associated protein like 1, mRNA
NCBI Official Synonym Full Names
echinoderm microtubule associated protein like 1
NCBI Official Symbol
EML1
NCBI Official Synonym Symbols
EMAP; ELP79; EMAPL; HuEMAP
NCBI Protein Information
echinoderm microtubule-associated protein-like 1
UniProt Protein Name
Echinoderm microtubule-associated protein-like 1
Protein Family
UniProt Gene Name
EML1
UniProt Synonym Gene Names
EMAP1; EMAPL; EMAPL1; EMAP-1; HuEMAP-1
UniProt Entry Name
EMAL1_HUMAN
NCBI Description
Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
EML1: May modify the assembly dynamics of microtubules, such that microtubules are slightly longer, but more dynamic. Belongs to the WD repeat EMAP family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Microtubule-binding; Cytoskeletal
Chromosomal Location of Human Ortholog: 14q32
Cellular Component: cytosol; microtubule associated complex
Molecular Function: microtubule binding; protein binding; tubulin binding
Biological Process: brain development; microtubule cytoskeleton organization and biogenesis; mitotic spindle organization and biogenesis; neuroblast proliferation
Research Articles on EML1
Similar Products
Product Notes
The EML1 eml1 (Catalog #AAA1270461) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggacg gcttctccag ctacagcagc ctgtacgaca cgtcctcgct gctccagttc tgcaacgatg acagcgcttc tgctgcaagt agcatggagg tgacagaccg cattgcttca ctggagcaga gagtccagat gcaagaagac gacatccagc tgctcaaatc agctctagct gatgtggttc ggcggctgaa cattactgag gaacagcagg ccgtgcttaa caggaaagga cctaccaaag caagaccact gatgcagacc ctgcccttaa gaaccacggt caacaatggc actgtgttac caaagaaacc tactggctct ctaccatccc cctccggggt caggaaagaa actgctgtgc cagcaaccaa aagtaacatc aagaggacca gctcttctga acgagtgtct cctgggggtc gaagggaaag caatggggat tccagaggaa accggaatcg cacaggctcc accagcagct cttccagtgg caaaaagaac agtgaaagca aacccaagga gcctgtattc agtgcagaag aaggctatgt aaaaatgttt cttcgtggac gccctgttac catgtacatg cccaaagatc aagtggattc ttacagcttg gaagcaaaag tagaacttcc aaccaagaga ctcaagctgg aatgggtcta tgggtacagg ggtcgagact gccgtaacaa cctgtacttg cttccgacgg gagagaccgt ctacttcatc gcatccgtgg tggtgttata caacgtggag gagcaactgc agaggcatta cgctggccac aacgatgacg tgaagtgcct agcagttcat cctgatcgga tcacgatagc aacaggacaa gttgcgggca catcgaagga tggaaaacaa ttgcccccac atgtgcgcat ctgggattct gtgacattga atactctcca cgtcattgga ataggttttt ttgaccgagc agtcacctgt attgcattct caaaatctaa tggaggaacc aatctctgtg ctgtggatga ctccaacgac catgtgctct ctgtatggga ctggcagaaa gaagaaaaac tagcagatgt gaagtgctct aatgaagctg tgtttgctgc ggatttccac cccacggaca ccaacatcat agttacttgt ggaaaatcac atctctactt ttggacacta gaaggaagct cccttaataa gaagcaagga ttattcgaga aacaagaaaa gccaaagttt gtcctctgtg tgactttctc tgaaaacggt gacaccatta ctggagattc aagtggcaac atcttagtat ggggaaaagg tacaaatcga ataagctatg cagttcaggg ggcccatgag ggtggcattt ttgcactttg tatgttaaga gatggcacac tggtgtcggg aggtgggaaa gaccgaaagc tcatttcttg gagcggaaac tatcaaaaac ttcgtaaaac ggagattcca gaacagtttg gtccaatacg gacagtggcc gaggggaaag gcgatgtgat cttgattggc acaactcgaa actttgtcct gcagggcact ctgtcagggg acttcacacc cattactcag ggtcacactg atgagctctg gggactggcc atccatgcct caaaacctca gttcttgacc tgtgggcatg acaagcatgc cactctctgg gacgctgtgg gtcaccgtcc cgtctgggac aaaataatag aggatccagc tcagtcttct ggttttcatc cttcagggtc tgtggttgca gtcggaacac tcactgggag gtggtttgtg tttgacacag aaacaaaaga cttggtcacc gttcacacag atggaaacga acagctctct gtaatgcgat actcaccaga tgggaatttc ttagccatag gctcacatga caactgcatc tatatatatg gcgttagtga caacgggagg aagtacacgc gagtgggcaa gtgctcgggt cattccagct tcattactca cctggactgg tctgtaaact cacagttcct cgtgtcaaat tccggagact acgaaatcct ctactgggtt ccctctgcct gtaagcaagt cgtaagtgtg gaaactacaa gagacattga atgggctacc tatacctgca ctttgggatt ccatgttttt ggagtgtggc cagaaggctc ggacggaacc gacatcaatg ccgtctgtcg ggcccatgag aagaaactcc tgtcaacagg cgacgacttt ggcaaagtgc acctcttctc atacccctgc tcgcagttca gggctccaag ccacatctac ggcgggcaca gcagccatgt caccaatgtc gatttcctct gtgaagacag ccacctcatc tccacgggcg ggaaagacac aagcatcatg cagtggcgcg tcatttag. It is sometimes possible for the material contained within the vial of "EML1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
