Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ELTD1 cdna clone

ELTD1 cDNA Clone

Gene Names
ADGRL4; ETL; ELTD1; KPG_003
Synonyms
ELTD1; ELTD1 cDNA Clone; ELTD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgtgtacctggcttcagatccagcagtaaccaagacaggtttatcactaatgatggaaccgtctgtatagaaaatgtgaatgcaaactgccatttagataatgtctgtatagctgcaaatattaataaaactttaacaaaaatcagatccataaaagaacctgtggctttgctacaagaagtctatagaaattctgtgacagatctttcaccaacagatataattacatatatagaaatattagctgaatcatcttcattactaggttacaagaacaacactatctcagccaaggacaccctttctaactcaactcttactgaatttgtaaaaaccgtgaataattttgttcaaagggatacatttgtagtttgggacaagttatctgtgaatcataggagaacacatcttacaaaactcatgcacactgttgaacaagctactttaaggatatcccagagcttccaaaagaccacagagtttgatacaaattcaacggatatagctctcaaagttttcttttttgattcatataacatgaaacatattcatcctcatatgaatatggatggagactacataaatatatttccaaagagaaaagctgcatatgattcaaatggcaatgttgcagttgcatttttatattataagagtattggtcctttgctttcatcatctgacaacttcttattgaaacctcaaaattatgataattctgaagaggaggaaagagtcatatcttcagtaatttcagtctcaatgagctcaaacccacccacattatatgaacttgaaaaaataacatttacattaagtcatcgaaaggtcacagataggtataggagtctatgtgcattttggaattactcacctgataccatgaatggcagctggtcttcagagggctgtgagctgacatactcaaatgagacccacacctcatgccgctgtaatcacctgacacattttgcaattttgatgtcctctggtccttccattggtattaaagattataatattcttacaaggatcactcaactaggaataattatttcactgatttgtcttgccatatgcatttttaccttctggttcttcagtgaaattcaaagcaccaggacaacaattcacaaaaatctttgctgtagcctatttcttgctgaacttgtttttcttgttgggatcaatacaaatactaataagctcttctgttcaatcattgctggactgctacactacttctttttagctgcttttgcatggatgtgcattgaaggcatacatctctatctcattgttgtgggtgtcatctacaacaagggatttttgcacaagaatttttatatctttggctatctaagcccagccgtggtagttggattttcggcagcactaggatacagatattatggcacaaccaaagtatgttggcttagcaccgaaaacaactttatttggagttttataggaccagcatgcctaatcattcttgttaatctcttggcttttggagtcatcatatacaaagtttttcgtcacactgcagggttgaaaccagaagttagttgctttgagaacataaggtcttgtgcaagaggagccctcgctcttctgttccttctcggcaccacctggatctttggggttctccatgttgtgcacgcatcagtggttacagcttacctcttcacagtcagcaatgctttccaggggatgttcatttttttattcctgtgtgttttatctagaaagattcaagaagaatattacagattgttcaaaaatgtcccctgttgttttggatgtttaaggtaa
Sequence Length
1821
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
77,811 Da
NCBI Official Full Name
Homo sapiens EGF, latrophilin and seven transmembrane domain containing 1, mRNA
NCBI Official Synonym Full Names
adhesion G protein-coupled receptor L4
NCBI Official Symbol
ADGRL4
NCBI Official Synonym Symbols
ETL; ELTD1; KPG_003
NCBI Protein Information
adhesion G protein-coupled receptor L4
UniProt Protein Name
Adhesion G protein-coupled receptor L4
UniProt Gene Name
ADGRL4
UniProt Synonym Gene Names
ETL protein
UniProt Entry Name
AGRL4_HUMAN

Uniprot Description

ELTD1: Could be involved in cardiac development. Belongs to the G-protein coupled receptor 2 family. LN-TM7 subfamily.

Protein type: GPCR, family 2; Membrane protein, integral; Membrane protein, multi-pass; Receptor, GPCR

Chromosomal Location of Human Ortholog: 1p33-p32

Cellular Component: cytoplasmic vesicle; plasma membrane

Research Articles on ELTD1

Similar Products

Product Notes

The ELTD1 adgrl4 (Catalog #AAA1266719) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtgtac ctggcttcag atccagcagt aaccaagaca ggtttatcac taatgatgga accgtctgta tagaaaatgt gaatgcaaac tgccatttag ataatgtctg tatagctgca aatattaata aaactttaac aaaaatcaga tccataaaag aacctgtggc tttgctacaa gaagtctata gaaattctgt gacagatctt tcaccaacag atataattac atatatagaa atattagctg aatcatcttc attactaggt tacaagaaca acactatctc agccaaggac accctttcta actcaactct tactgaattt gtaaaaaccg tgaataattt tgttcaaagg gatacatttg tagtttggga caagttatct gtgaatcata ggagaacaca tcttacaaaa ctcatgcaca ctgttgaaca agctacttta aggatatccc agagcttcca aaagaccaca gagtttgata caaattcaac ggatatagct ctcaaagttt tcttttttga ttcatataac atgaaacata ttcatcctca tatgaatatg gatggagact acataaatat atttccaaag agaaaagctg catatgattc aaatggcaat gttgcagttg catttttata ttataagagt attggtcctt tgctttcatc atctgacaac ttcttattga aacctcaaaa ttatgataat tctgaagagg aggaaagagt catatcttca gtaatttcag tctcaatgag ctcaaaccca cccacattat atgaacttga aaaaataaca tttacattaa gtcatcgaaa ggtcacagat aggtatagga gtctatgtgc attttggaat tactcacctg ataccatgaa tggcagctgg tcttcagagg gctgtgagct gacatactca aatgagaccc acacctcatg ccgctgtaat cacctgacac attttgcaat tttgatgtcc tctggtcctt ccattggtat taaagattat aatattctta caaggatcac tcaactagga ataattattt cactgatttg tcttgccata tgcattttta ccttctggtt cttcagtgaa attcaaagca ccaggacaac aattcacaaa aatctttgct gtagcctatt tcttgctgaa cttgtttttc ttgttgggat caatacaaat actaataagc tcttctgttc aatcattgct ggactgctac actacttctt tttagctgct tttgcatgga tgtgcattga aggcatacat ctctatctca ttgttgtggg tgtcatctac aacaagggat ttttgcacaa gaatttttat atctttggct atctaagccc agccgtggta gttggatttt cggcagcact aggatacaga tattatggca caaccaaagt atgttggctt agcaccgaaa acaactttat ttggagtttt ataggaccag catgcctaat cattcttgtt aatctcttgg cttttggagt catcatatac aaagtttttc gtcacactgc agggttgaaa ccagaagtta gttgctttga gaacataagg tcttgtgcaa gaggagccct cgctcttctg ttccttctcg gcaccacctg gatctttggg gttctccatg ttgtgcacgc atcagtggtt acagcttacc tcttcacagt cagcaatgct ttccagggga tgttcatttt tttattcctg tgtgttttat ctagaaagat tcaagaagaa tattacagat tgttcaaaaa tgtcccctgt tgttttggat gtttaaggta a. It is sometimes possible for the material contained within the vial of "ELTD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.