Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ELAVL2 cdna clone

ELAVL2 cDNA Clone

Gene Names
ELAVL2; HUB; HELN1; HEL-N1
Synonyms
ELAVL2; ELAVL2 cDNA Clone; ELAVL2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaacacaactgtctaatgggccaacttgcaataacacagccaatggtccaaccaccataaacaacaactgttcgtcaccagttgactctgggaacacagaagacagcaagaccaacttaatagtcaactaccttcctcagaacatgacacaggaggaactaaagagtctctttgggagcattggtgaaatagagtcctgtaagcttgtaagagacaaaataacagggcagagcttgggatatggctttgtgaactacattgaccccaaggatgcagagaaagctatcaacaccctgaatggattgagacttcaaaccaaaacaataaaagtttcctatgctcgcccaagttcagcttctatcagagatgcaaatttatatgtcagcggacttccaaaaacaatgacccagaaggagttggaacagcttttttcacaatatggacgcattattacttctcgtattcttgtcgaccaggtcactggcatatcaaggggtgtagggtttattcgatttgacaagcgaattgaggcagaagaagctatcaaaggcctaaatggccagaaacctcccggtgccacggagccaatcactgtaaagtttgctaataacccaagccaaaaaaccaatcaggccatcctttcccagctgtaccagtctccaaacagaaggtatccaggaccgctagctcagcaggcacagcgttttaggttttctccaatgaccattgacggaatgaccagtttggctggaattaatatccctgggcaccctggaacagggtggtgtatatttgtgtacaacctggctcctgacgcagatgagagtatcctgtggcaaatgtttgggccttttggagctgtcaccaatgtgaaggtcatccgtgactttaacaccaataaatgcaaaggttttggatttgtgactatgacaaactatgatgaggctgccatggcgatagctagcctcaatggataccgtctgggagacagagtactgcaggtctcctttaagacaaacaaaacgcacaaagcctaa
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,015 Da
NCBI Official Full Name
Homo sapiens ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B), mRNA
NCBI Official Synonym Full Names
ELAV like RNA binding protein 2
NCBI Official Symbol
ELAVL2
NCBI Official Synonym Symbols
HUB; HELN1; HEL-N1
NCBI Protein Information
ELAV-like protein 2
UniProt Protein Name
ELAV-like protein 2
Protein Family
UniProt Gene Name
ELAVL2
UniProt Synonym Gene Names
HUB; HuB
UniProt Entry Name
ELAV2_HUMAN

NCBI Description

The protein encoded by this gene is a neural-specific RNA-binding protein that is known to bind to several 3' UTRs, including its own and also that of FOS and ID. The encoded protein may recognize a GAAA motif in the RNA. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]

Uniprot Description

ELAVL2: Binds RNA. Seems to recognize a GAAA motif. Can bind to its own 3'-UTR, the FOS 3'-UTR and the ID 3'-UTR. Belongs to the RRM elav family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding

Chromosomal Location of Human Ortholog: 9p21

Cellular Component: nucleoplasm

Molecular Function: mRNA 3'-UTR binding; protein binding

Biological Process: nuclear mRNA splicing, via spliceosome; regulation of transcription, DNA-dependent

Research Articles on ELAVL2

Similar Products

Product Notes

The ELAVL2 elavl2 (Catalog #AAA1275938) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaacac aactgtctaa tgggccaact tgcaataaca cagccaatgg tccaaccacc ataaacaaca actgttcgtc accagttgac tctgggaaca cagaagacag caagaccaac ttaatagtca actaccttcc tcagaacatg acacaggagg aactaaagag tctctttggg agcattggtg aaatagagtc ctgtaagctt gtaagagaca aaataacagg gcagagcttg ggatatggct ttgtgaacta cattgacccc aaggatgcag agaaagctat caacaccctg aatggattga gacttcaaac caaaacaata aaagtttcct atgctcgccc aagttcagct tctatcagag atgcaaattt atatgtcagc ggacttccaa aaacaatgac ccagaaggag ttggaacagc ttttttcaca atatggacgc attattactt ctcgtattct tgtcgaccag gtcactggca tatcaagggg tgtagggttt attcgatttg acaagcgaat tgaggcagaa gaagctatca aaggcctaaa tggccagaaa cctcccggtg ccacggagcc aatcactgta aagtttgcta ataacccaag ccaaaaaacc aatcaggcca tcctttccca gctgtaccag tctccaaaca gaaggtatcc aggaccgcta gctcagcagg cacagcgttt taggttttct ccaatgacca ttgacggaat gaccagtttg gctggaatta atatccctgg gcaccctgga acagggtggt gtatatttgt gtacaacctg gctcctgacg cagatgagag tatcctgtgg caaatgtttg ggccttttgg agctgtcacc aatgtgaagg tcatccgtga ctttaacacc aataaatgca aaggttttgg atttgtgact atgacaaact atgatgaggc tgccatggcg atagctagcc tcaatggata ccgtctggga gacagagtac tgcaggtctc ctttaagaca aacaaaacgc acaaagccta a. It is sometimes possible for the material contained within the vial of "ELAVL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.