Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF4G3 cdna clone

EIF4G3 cDNA Clone

Gene Names
EIF4G3; eIF4G 3; eIF4GII; eIF-4G 3
Synonyms
EIF4G3; EIF4G3 cDNA Clone; EIF4G3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaattcacaacctcaaacccgttctccgtttgcagcggggcctcgacctccccatcatcagtttttccagaggcctcaaatacagcctcctagagctaccatcccgaacagcagtccttccattcgtcctggtgcacagacacccactgcagtgtaccaggctaatcagcacatcatgatggttaaccatctgcccatgccgtacccagtgccccaggggcctcagtactgtataccacagtaccgtcatagtggccctccttatgttgggcccccccaacaatatccagttcaaccaccggggccaggtcctttttatcctggaccaggacctggggacttccccaatgcttatggaacgcctttttacccaagtcagccggtgtatcagtcagcacctatcatagtgcctacgcagcaacagccgcctccagccaagagagagaaaaaaactataagaattcgggatccaaaccagggaggtaaagacataacagaggagattatatctggaggtggcagcagaaatcctactccacccataggaagacccacgtccacacctactcctcctcagcagctgcccagccaggtccccgagcacagccctgtggtttatgggactgtggagagcgctcatcttgctgccagcacccctgtcactgcagctagcgaccagaagcaagaggagaagccaaaaccagatccagtgttaaagtctccttccccagtccttaggctagtcctcagtggagagaagaaagaacaagaaggccagacatctgaaactactgcaatagtatccatagcagagcttcctctgcctccatcacctaccactgtttcttctgttgctcgaagtacaattgcagcccccacctcttctgctcttagtagccaaccaatattcaccactgctatagatgacaggtgtgaactctcatccccaagagaagacacaattcctatacccagcctcacatcttgcacagaaacatcagaccctttaccaacaaatgaaaatgatggtgatatatgcaagaaaccctgtagtgtagcacctaatgatattccactggtttctagtactaacctaattaatgaaataaatggagttagcgaaaaattatcagccacggagagcattgtggaaatagtaaaacaggaagtattgccattgactcttgaattggagattctcgaaaatcccccagaagaaatgaaactggagtgtatcccagctcccatcaccccttccacagttccttcctttcctccaactcctccaactcctccagcttctcctcctcacactccagtcattgttcctgctgctgccactactgttagttctccgagtgctgccatcacagtccagagagtcctagaggaggacgagagcataagaacttgccttagtgaagatgcaaaagagattcagaacaaaatagaggtagaagcagatgggcaaacagaagagattttggattctcaaaacttaaattcaagaaggagccctgtcccagaaacatcgaatgaatgctga
Sequence Length
1548
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
146,871 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 4 gamma, 3, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 4 gamma 3
NCBI Official Symbol
EIF4G3
NCBI Official Synonym Symbols
eIF4G 3; eIF4GII; eIF-4G 3
NCBI Protein Information
eukaryotic translation initiation factor 4 gamma 3
UniProt Protein Name
Eukaryotic translation initiation factor 4 gamma 3
UniProt Gene Name
EIF4G3
UniProt Synonym Gene Names
eIF-4-gamma 3; eIF-4G 3; eIF4G 3; eIF4GII
UniProt Entry Name
IF4G3_HUMAN

NCBI Description

The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]

Uniprot Description

EIF4G3: Probable component of the protein complex eIF4F, which is involved in the recognition of the mRNA cap, ATP-dependent unwinding of 5'-terminal secondary structure and recruitment of mRNA to the ribosome. Thought to be a functional homolog of EIF4G1. Interacts with EIF4A, EIF4E, eIF3 and PABPC1. Part of a complex with EIF4E. eIF4F is a multi-subunit complex, the composition of which varies with external and internal environmental conditions. It is composed of at least EIF4A, EIF4E and EIF4G1/EIF4G3. EIF4G1/EIF4G3 interacts through its C-terminus with the serine/threonine kinases MKNK1, and with MKNK2. Appears to act as a scaffold protein, holding these enzymes in place to phosphorylate eIF4E. Non-phosphorylated EIF4EBP1 competes with EIF4G1/EIFG3 to interact with EIF4E; insulin stimulated MAP-kinase (MAPK1 and MAPK3) phosphorylation of EIF4EBP1 causes dissociation of the complex allowing EIF4G1/EIF4G3 to bind and consequent initiation of translation. EIF4G1/EIF4G3 interacts with PABPC1 to bring about circularization of the mRNA. Belongs to the eIF4G family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Translation initiation; Translation; RNA-binding

Chromosomal Location of Human Ortholog: 1p36.12

Cellular Component: cytosol; eukaryotic translation initiation factor 4F complex

Molecular Function: RNA cap binding; translation factor activity, nucleic acid binding

Biological Process: regulation of translational initiation

Research Articles on EIF4G3

Similar Products

Product Notes

The EIF4G3 eif4g3 (Catalog #AAA1271590) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaattcac aacctcaaac ccgttctccg tttgcagcgg ggcctcgacc tccccatcat cagtttttcc agaggcctca aatacagcct cctagagcta ccatcccgaa cagcagtcct tccattcgtc ctggtgcaca gacacccact gcagtgtacc aggctaatca gcacatcatg atggttaacc atctgcccat gccgtaccca gtgccccagg ggcctcagta ctgtatacca cagtaccgtc atagtggccc tccttatgtt gggccccccc aacaatatcc agttcaacca ccggggccag gtccttttta tcctggacca ggacctgggg acttccccaa tgcttatgga acgccttttt acccaagtca gccggtgtat cagtcagcac ctatcatagt gcctacgcag caacagccgc ctccagccaa gagagagaaa aaaactataa gaattcggga tccaaaccag ggaggtaaag acataacaga ggagattata tctggaggtg gcagcagaaa tcctactcca cccataggaa gacccacgtc cacacctact cctcctcagc agctgcccag ccaggtcccc gagcacagcc ctgtggttta tgggactgtg gagagcgctc atcttgctgc cagcacccct gtcactgcag ctagcgacca gaagcaagag gagaagccaa aaccagatcc agtgttaaag tctccttccc cagtccttag gctagtcctc agtggagaga agaaagaaca agaaggccag acatctgaaa ctactgcaat agtatccata gcagagcttc ctctgcctcc atcacctacc actgtttctt ctgttgctcg aagtacaatt gcagccccca cctcttctgc tcttagtagc caaccaatat tcaccactgc tatagatgac aggtgtgaac tctcatcccc aagagaagac acaattccta tacccagcct cacatcttgc acagaaacat cagacccttt accaacaaat gaaaatgatg gtgatatatg caagaaaccc tgtagtgtag cacctaatga tattccactg gtttctagta ctaacctaat taatgaaata aatggagtta gcgaaaaatt atcagccacg gagagcattg tggaaatagt aaaacaggaa gtattgccat tgactcttga attggagatt ctcgaaaatc ccccagaaga aatgaaactg gagtgtatcc cagctcccat caccccttcc acagttcctt cctttcctcc aactcctcca actcctccag cttctcctcc tcacactcca gtcattgttc ctgctgctgc cactactgtt agttctccga gtgctgccat cacagtccag agagtcctag aggaggacga gagcataaga acttgcctta gtgaagatgc aaaagagatt cagaacaaaa tagaggtaga agcagatggg caaacagaag agattttgga ttctcaaaac ttaaattcaa gaaggagccc tgtcccagaa acatcgaatg aatgctga. It is sometimes possible for the material contained within the vial of "EIF4G3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.