Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF3E cdna clone

EIF3E cDNA Clone

Gene Names
EIF3E; INT6; EIF3S6; EIF3-P48; eIF3-p46
Synonyms
EIF3E; EIF3E cDNA Clone; EIF3E cdna clone
Ordering
For Research Use Only!
Sequence
atggcggagtacgacttgactactcgcatcgcgcactttttggatcggcatctagtctttccgcttcttgaatttctctctgtaaaggagatatataatgaaaaggaattattacaaggtaaattggaccttcttagtgataccaacatggtagactttgctatggatgtatacaaaaacctttattctgatgatattcctcatgctttgagagagaaaagaaccacagtggttgcacaactgaaacagcttcaggcagaaacagaaccaattgtgaagatgtttgaagatccagaaactacaaggcaaatgcagtcaaccagggatggtaggatgctctttgactacctggcggacaagcatggttttaggcaggaatatttagatacactctacagatatgcaaaattccagtacgaatgtgggaattactcaggagcagcagaatatctttatttttttagagtgctggttccagcaacagatagaaatgctttaagttcactctggggaaagctggcctctgaaatcttaatgcagaattgggatgcagccatggaagaccttacacggttaaaagagaccatagataataattctgtgagttctccacttcagtctcttcagcagagaacatggctcattcactggtctctgtttgttttcttcaatcaccccaaaggtcgcgataatattattgacctcttcctttatcagccacaatatcttaatgcaattcagacaatgtgtccacacattcttcgctatttgactacagcagtcataacaaacaaggatgttcgaaaacgtcggcaggttctaaaagatctagttaaagttattcaacaggagtcttacacatataaagacccaattacagaatttgttgaatgtttatatgttaactttgactttgatggggctcagaaaaagctgagggaatgtgaatcagtgcttgtgaatgacttcttcttggtggcttgtcttgaggatttcattgaaaatgcccgtctcttcatatttgagactttctgtcgcatccaccagtgtatcagcattaacatgttggcagataaattgaacatgactccagaagaagctgaaaggtggattgtaaatttgattagaaatgcaagactggatgccaagattgattctaaattaggtcatgtggttatgggtaacaatgcagtctcaccctatcagcaagtgattgaaaagaccaaaagcctttcctttagaagccagatgttggccatgaatattgagaagaaacttaatcagaatagcaggtcagaggctcctaactgggcaactcaagattctggcttctactg
Sequence Length
1337
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,221 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 3, subunit E, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 3 subunit E
NCBI Official Symbol
EIF3E
NCBI Official Synonym Symbols
INT6; EIF3S6; EIF3-P48; eIF3-p46
NCBI Protein Information
eukaryotic translation initiation factor 3 subunit E
UniProt Protein Name
Eukaryotic translation initiation factor 3 subunit E
UniProt Gene Name
EIF3E
UniProt Synonym Gene Names
eIF3e
UniProt Entry Name
EIF3E_HUMAN

Uniprot Description

EIF3E: eukaryotic translation initiation factor 3 subunit 2. Binds to the 40S ribosome and promotes the binding of methionyl-tRNAi and mRNA. eIF-3 is composed of at least 12 different subunits. Phosphorylated by TGF-beta type II receptor.

Protein type: Translation initiation; Translation

Chromosomal Location of Human Ortholog: 8q22-q23

Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; eukaryotic translation initiation factor 3 complex; membrane; nucleus; PML body

Molecular Function: protein binding; protein N-terminus binding; translation initiation factor activity

Biological Process: mRNA catabolic process, nonsense-mediated decay; translational initiation

Research Articles on EIF3E

Similar Products

Product Notes

The EIF3E eif3e (Catalog #AAA1272009) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagt acgacttgac tactcgcatc gcgcactttt tggatcggca tctagtcttt ccgcttcttg aatttctctc tgtaaaggag atatataatg aaaaggaatt attacaaggt aaattggacc ttcttagtga taccaacatg gtagactttg ctatggatgt atacaaaaac ctttattctg atgatattcc tcatgctttg agagagaaaa gaaccacagt ggttgcacaa ctgaaacagc ttcaggcaga aacagaacca attgtgaaga tgtttgaaga tccagaaact acaaggcaaa tgcagtcaac cagggatggt aggatgctct ttgactacct ggcggacaag catggtttta ggcaggaata tttagataca ctctacagat atgcaaaatt ccagtacgaa tgtgggaatt actcaggagc agcagaatat ctttattttt ttagagtgct ggttccagca acagatagaa atgctttaag ttcactctgg ggaaagctgg cctctgaaat cttaatgcag aattgggatg cagccatgga agaccttaca cggttaaaag agaccataga taataattct gtgagttctc cacttcagtc tcttcagcag agaacatggc tcattcactg gtctctgttt gttttcttca atcaccccaa aggtcgcgat aatattattg acctcttcct ttatcagcca caatatctta atgcaattca gacaatgtgt ccacacattc ttcgctattt gactacagca gtcataacaa acaaggatgt tcgaaaacgt cggcaggttc taaaagatct agttaaagtt attcaacagg agtcttacac atataaagac ccaattacag aatttgttga atgtttatat gttaactttg actttgatgg ggctcagaaa aagctgaggg aatgtgaatc agtgcttgtg aatgacttct tcttggtggc ttgtcttgag gatttcattg aaaatgcccg tctcttcata tttgagactt tctgtcgcat ccaccagtgt atcagcatta acatgttggc agataaattg aacatgactc cagaagaagc tgaaaggtgg attgtaaatt tgattagaaa tgcaagactg gatgccaaga ttgattctaa attaggtcat gtggttatgg gtaacaatgc agtctcaccc tatcagcaag tgattgaaaa gaccaaaagc ctttccttta gaagccagat gttggccatg aatattgaga agaaacttaa tcagaatagc aggtcagagg ctcctaactg ggcaactcaa gattctggct tctactg. It is sometimes possible for the material contained within the vial of "EIF3E, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.