EIF2C3 cdna clone
EIF2C3 cDNA Clone
Gene Names
AGO3; EIF2C3
Synonyms
EIF2C3; EIF2C3 cDNA Clone; EIF2C3 cdna clone
Sequence
atggaaatcggctccgcaggacccgctggggcccagcccctactcatggtgcccagaagacctggctatggcaccatgggcaaacccattaaactgctggctaactgttttcaagttgaaatcccaaagattgatgtctacctctatgaggtagatattaaaccagacaagtgtcctaggagagtgaacagggaggtggttgactcaatggttcagcattttaaagtaactatatttggagaccgtagaccagtttataatggaaaaagaagtctttacaccgccaatccacttcctgtggcaactacaggggtagatttagacgttactttacctggggaaggtggaaaagatcgacctttcaaggtgtcaatcaaatttgtctctcgggtgagttggcacctactgcatgaagtactgacaggacggaccttgcctgagccactggaattagacaagccaatcagcactaaccctgtccatgccgttgatgtggtgctacgacatctgccctccatgaaatacacacctgtggggcgttcatttttctccgctccagaaggatatgaccaccctctgggagggggcagggaagtgtggtttggattccatcagtctgttcggcctgccatgtggaaaatgatgcttaatatcgatgaaagagacctctggcagcagtgtggagaatag
Sequence Length
690
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,760 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 2C, 3, mRNA
NCBI Official Synonym Full Names
argonaute 3, RISC catalytic component
NCBI Official Symbol
AGO3
NCBI Official Synonym Symbols
EIF2C3
NCBI Protein Information
protein argonaute-3
UniProt Protein Name
EIF2C3 protein
UniProt Gene Name
EIF2C3
UniProt Entry Name
Q6NXU1_HUMAN
NCBI Description
This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, contains a PAZ domain and a PIWI domain, and may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a tandem cluster of closely related family members including argonaute 4 and eukaryotic translation initiation factor 2C, 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Research Articles on EIF2C3
Similar Products
Product Notes
The EIF2C3 eif2c3 (Catalog #AAA1272797) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaatcg gctccgcagg acccgctggg gcccagcccc tactcatggt gcccagaaga cctggctatg gcaccatggg caaacccatt aaactgctgg ctaactgttt tcaagttgaa atcccaaaga ttgatgtcta cctctatgag gtagatatta aaccagacaa gtgtcctagg agagtgaaca gggaggtggt tgactcaatg gttcagcatt ttaaagtaac tatatttgga gaccgtagac cagtttataa tggaaaaaga agtctttaca ccgccaatcc acttcctgtg gcaactacag gggtagattt agacgttact ttacctgggg aaggtggaaa agatcgacct ttcaaggtgt caatcaaatt tgtctctcgg gtgagttggc acctactgca tgaagtactg acaggacgga ccttgcctga gccactggaa ttagacaagc caatcagcac taaccctgtc catgccgttg atgtggtgct acgacatctg ccctccatga aatacacacc tgtggggcgt tcatttttct ccgctccaga aggatatgac caccctctgg gagggggcag ggaagtgtgg tttggattcc atcagtctgt tcggcctgcc atgtggaaaa tgatgcttaa tatcgatgaa agagacctct ggcagcagtg tggagaatag. It is sometimes possible for the material contained within the vial of "EIF2C3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
