Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EGR2 cdna clone

EGR2 cDNA Clone

Gene Names
EGR2; AT591; CMT1D; CMT4E; KROX20
Synonyms
EGR2; EGR2 cDNA Clone; EGR2 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgaccgccaaggccgtagacaaaatcccagtaactctcagtggttttgtgcaccagctgtctgacaacatctacccggtggaggacctcgccgccacgtcggtgaccatctttcccaatgccgaactgggaggcccctttgaccagatgaacggagtggccggagatggcatgatcaacattgacatgactggagagaagaggtcgttggatctcccatatcccagcagctttgctcccgtctctgcacctagaaaccagaccttcacttacatgggcaagttctccattgaccctcagtaccctggtgccagctgctacccagaaggcataatcaatattgtgagtgcaggcatcttgcaaggggtcacttccccagcttcaaccacagcctcatccagcgtcacctctgcctcccccaacccactggccacaggacccctgggtgtgtgcaccatgtcccagacccagcctgacctggaccacctgtactctccgccaccgcctcctcctccttattctggctgtgcaggagacctctaccaggacccttctgcgttcctgtcagcagccaccacctccacctcttcctctctggcctacccaccacctccttcctatccatcccccaagccagccacggacccaggtctcttcccaatgatcccagactatcctggattctttccatctcagtgccagagagacctacatggtacagctggcccagaccgtaagccctttccctgcccactggacaccctgcgggtgccccctccactcactccactctctacaatccgtaagccctttccctgcccactggacaccctgcgggtgccccctccactcactccactctctacaatccgtaactttaccctggggggccccagtgctggggtgaccggaccaggggccagtggaggcagcgagggaccccggctgcctggtagcagctcagcagcagcagcagccgccgccgccgccgcctataacccacaccacctgccactgcggcccattctgaggcctcgcaagtaccccaacagacccagcaagacgccggtgcacgagaggccctacccgtgcccagcagaaggctgcgaccggcggttctcccgctctgacgagctgacacggcacatccgaatccacactgggcataagcccttccagtgtcggatctgcatgcgcaacttcagccgcagtgaccacctcaccacccatatccgcacccacaccggtgagaagcccttcgcctgtgactactgtggccgaaagtttgcccggagtgatgagaggaagcgccacaccaagatccacctgagacagaaagagcggaaaagcagtgccccctctgcatcggtgccagccccctctacagcctcctgctctgggggcgtgcagcctgggggtaccctgtgcagcagtaacagcagcagtcttggcggagggccgctcgccccttgctcctctcggacccggacaccttga
Sequence Length
1500
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,970 Da
NCBI Official Full Name
Homo sapiens early growth response 2 (Krox-20 homolog, Drosophila), mRNA
NCBI Official Synonym Full Names
early growth response 2
NCBI Official Symbol
EGR2
NCBI Official Synonym Symbols
AT591; CMT1D; CMT4E; KROX20
NCBI Protein Information
E3 SUMO-protein ligase EGR2
UniProt Protein Name
E3 SUMO-protein ligase EGR2
Protein Family
UniProt Gene Name
EGR2
UniProt Synonym Gene Names
KROX20; EGR-2
UniProt Entry Name
EGR2_HUMAN

NCBI Description

The protein encoded by this gene is a transcription factor with three tandem C2H2-type zinc fingers. Defects in this gene are associated with Charcot-Marie-Tooth disease type 1D (CMT1D), Charcot-Marie-Tooth disease type 4E (CMT4E), and with Dejerine-Sottas syndrome (DSS). Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]

Uniprot Description

EGR2: Sequence-specific DNA-binding transcription factor. Binds to two specific DNA sites located in the promoter region of HOXA4. Defects in EGR2 are a cause of congenital hypomyelination neuropathy (CHN). Inheritance can be autosomal dominant or recessive. Recessive CHN is also known as Charcot- Marie-Tooth disease type 4E (CMT4E). CHN is characterized clinically by early onset of hypotonia, areflexia, distal muscle weakness, and very slow nerve conduction velocities. Defects in EGR2 are a cause of Charcot-Marie-Tooth disease type 1D (CMT1D). CMT1D is a form of Charcot- Marie-Tooth disease, the most common inherited disorder of the peripheral nervous system. Charcot-Marie-Tooth disease is classified in two main groups on the basis of electrophysiologic properties and histopathology: primary peripheral demyelinating neuropathy or CMT1, and primary peripheral axonal neuropathy or CMT2. Neuropathies of the CMT1 group are characterized by severely reduced nerve conduction velocities (less than 38 m/sec), segmental demyelination and remyelination with onion bulb formations on nerve biopsy, slowly progressive distal muscle atrophy and weakness, absent deep tendon reflexes, and hollow feet. Defects in EGR2 are a cause of Dejerine-Sottas syndrome (DSS); also known as Dejerine-Sottas neuropathy (DSN) or hereditary motor and sensory neuropathy III (HMSN3). DSS is a severe degenerating neuropathy of the demyelinating Charcot-Marie- Tooth disease category, with onset by age 2 years. DSS is characterized by motor and sensory neuropathy with very slow nerve conduction velocities, increased cerebrospinal fluid protein concentrations, hypertrophic nerve changes, delayed age of walking as well as areflexia. There are both autosomal dominant and autosomal recessive forms of Dejerine-Sottas syndrome. Belongs to the EGR C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; EC 6.3.2.-; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 10q21.1

Cellular Component: cytoplasm; nucleus

Molecular Function: chromatin binding; protein binding; transcription factor activity; ubiquitin protein ligase binding

Biological Process: brain development; fat cell differentiation; peripheral nervous system development; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; protein export from nucleus; transcription from RNA polymerase II promoter

Disease: Charcot-marie-tooth Disease, Demyelinating, Type 1d; Hypertrophic Neuropathy Of Dejerine-sottas; Neuropathy, Congenital Hypomyelinating Or Amyelinating, Autosomal Recessive

Research Articles on EGR2

Similar Products

Product Notes

The EGR2 egr2 (Catalog #AAA1267179) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgaccg ccaaggccgt agacaaaatc ccagtaactc tcagtggttt tgtgcaccag ctgtctgaca acatctaccc ggtggaggac ctcgccgcca cgtcggtgac catctttccc aatgccgaac tgggaggccc ctttgaccag atgaacggag tggccggaga tggcatgatc aacattgaca tgactggaga gaagaggtcg ttggatctcc catatcccag cagctttgct cccgtctctg cacctagaaa ccagaccttc acttacatgg gcaagttctc cattgaccct cagtaccctg gtgccagctg ctacccagaa ggcataatca atattgtgag tgcaggcatc ttgcaagggg tcacttcccc agcttcaacc acagcctcat ccagcgtcac ctctgcctcc cccaacccac tggccacagg acccctgggt gtgtgcacca tgtcccagac ccagcctgac ctggaccacc tgtactctcc gccaccgcct cctcctcctt attctggctg tgcaggagac ctctaccagg acccttctgc gttcctgtca gcagccacca cctccacctc ttcctctctg gcctacccac cacctccttc ctatccatcc cccaagccag ccacggaccc aggtctcttc ccaatgatcc cagactatcc tggattcttt ccatctcagt gccagagaga cctacatggt acagctggcc cagaccgtaa gccctttccc tgcccactgg acaccctgcg ggtgccccct ccactcactc cactctctac aatccgtaag ccctttccct gcccactgga caccctgcgg gtgccccctc cactcactcc actctctaca atccgtaact ttaccctggg gggccccagt gctggggtga ccggaccagg ggccagtgga ggcagcgagg gaccccggct gcctggtagc agctcagcag cagcagcagc cgccgccgcc gccgcctata acccacacca cctgccactg cggcccattc tgaggcctcg caagtacccc aacagaccca gcaagacgcc ggtgcacgag aggccctacc cgtgcccagc agaaggctgc gaccggcggt tctcccgctc tgacgagctg acacggcaca tccgaatcca cactgggcat aagcccttcc agtgtcggat ctgcatgcgc aacttcagcc gcagtgacca cctcaccacc catatccgca cccacaccgg tgagaagccc ttcgcctgtg actactgtgg ccgaaagttt gcccggagtg atgagaggaa gcgccacacc aagatccacc tgagacagaa agagcggaaa agcagtgccc cctctgcatc ggtgccagcc ccctctacag cctcctgctc tgggggcgtg cagcctgggg gtaccctgtg cagcagtaac agcagcagtc ttggcggagg gccgctcgcc ccttgctcct ctcggacccg gacaccttga. It is sometimes possible for the material contained within the vial of "EGR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.