Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EGFL8 cdna clone

EGFL8 cDNA Clone

Gene Names
EGFL8; NG3; C6orf8
Synonyms
EGFL8; EGFL8 cDNA Clone; EGFL8 cdna clone
Ordering
For Research Use Only!
Sequence
atggggtccagggctgagctgtgcactctcttaggcggattctccttcctcctgctactgataccaggcgagggggccaagggtggatccctcagagagagtcagggagtctgctccaagcagacactggtggtcccgctccactacaacgagtcctacagccaaccagtgtacaagccctacctgaccttgtgcgctgggaggcgcatctgcagcacttacaggaccatgtaccgcgttatgtggcgggaggtgaggcgggaggttcagcagacccatgcagtgtgctgccagggctggaagaagcggcacccgggggcgctcacctgtgaagccatctgcgccaagccttgcctgaacggaggcgtctgcgttaggcctgaccagtgcgagtgcgcccccggctggggagggaagcactgtcatgtggacgtggatgaatgtaggaccagcatcaccctctgctcgcaccattgttttaatacggcaggcagcttcacctgcggctgcccccatgacctagtgctaggcgtggacgggcgcacctgcatggaggggtccccagagcccccaaccagtgccagcatactcagcgtggccgttcgggaggcggaaaaagatgagcgcgctctgaagcaggagattcacgagctgcgagggcgcctggagcggctggagcagtgggccggtcaggctggggcctgggtcagagcggtgctgcccgtgccgcctgaagagctgcagccagaacaggtggctgagctgtggggccggggtgaccggatcgaatctctcagcgaccaggtgctgctgctgcaggagaggctaggtgcctgctcctgtgaggacaacagcctgggcctcggcgtcaatcatcgataa
Sequence Length
882
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,262 Da
NCBI Official Full Name
Homo sapiens EGF-like-domain, multiple 8, mRNA
NCBI Official Synonym Full Names
EGF like domain multiple 8
NCBI Official Symbol
EGFL8
NCBI Official Synonym Symbols
NG3; C6orf8
NCBI Protein Information
epidermal growth factor-like protein 8
UniProt Protein Name
Epidermal growth factor-like protein 8
UniProt Gene Name
EGFL8
UniProt Synonym Gene Names
C6orf8; NG3; EGF-like protein 8; VE-statin-2
UniProt Entry Name
EGFL8_HUMAN

Uniprot Description

EGFL8:

Protein type: Membrane protein, integral; Secreted; Calcium-binding; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 6p21.32

Biological Process: in utero embryonic development

Research Articles on EGFL8

Similar Products

Product Notes

The EGFL8 egfl8 (Catalog #AAA1275880) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggtcca gggctgagct gtgcactctc ttaggcggat tctccttcct cctgctactg ataccaggcg agggggccaa gggtggatcc ctcagagaga gtcagggagt ctgctccaag cagacactgg tggtcccgct ccactacaac gagtcctaca gccaaccagt gtacaagccc tacctgacct tgtgcgctgg gaggcgcatc tgcagcactt acaggaccat gtaccgcgtt atgtggcggg aggtgaggcg ggaggttcag cagacccatg cagtgtgctg ccagggctgg aagaagcggc acccgggggc gctcacctgt gaagccatct gcgccaagcc ttgcctgaac ggaggcgtct gcgttaggcc tgaccagtgc gagtgcgccc ccggctgggg agggaagcac tgtcatgtgg acgtggatga atgtaggacc agcatcaccc tctgctcgca ccattgtttt aatacggcag gcagcttcac ctgcggctgc ccccatgacc tagtgctagg cgtggacggg cgcacctgca tggaggggtc cccagagccc ccaaccagtg ccagcatact cagcgtggcc gttcgggagg cggaaaaaga tgagcgcgct ctgaagcagg agattcacga gctgcgaggg cgcctggagc ggctggagca gtgggccggt caggctgggg cctgggtcag agcggtgctg cccgtgccgc ctgaagagct gcagccagaa caggtggctg agctgtgggg ccggggtgac cggatcgaat ctctcagcga ccaggtgctg ctgctgcagg agaggctagg tgcctgctcc tgtgaggaca acagcctggg cctcggcgtc aatcatcgat aa. It is sometimes possible for the material contained within the vial of "EGFL8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.