Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EFNB2 cdna clone

EFNB2 cDNA Clone

Gene Names
EFNB2; HTKL; EPLG5; Htk-L; LERK5
Synonyms
EFNB2; EFNB2 cDNA Clone; EFNB2 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgtgagaagggactccgtgtggaagtactgctggggtgttttgatggttttatgcagaactgcgatttccaaatcgatagttttagagcctatctattggaattcctcgaactccaaatttctacctggacaaggactggtactatacccacagataggagacaaattggatattatttgccccaaagtggactctaaaactgttggccagtatgaatattataaagtttatatggttgataaagaccaagcagacagatgcactattaagaaggaaaatacccctctcctcaactgtgccaaaccagaccaagatatcaaattcaccatcaagtttcaagaattcagccctaacctctggggtctagaatttcagaagaacaaagattattacattatatctacatcaaatgggtctttggagggcctggataaccaggagggaggggtgtgccagacaagagccatgaagatcctcatgaaagttggacaagatgcaagttctgctggatcaaccaggaataaagatccaacaagacgtccagaactagaagctggtacaaatggaagaagttcgacaacaagtccctttgtaaaaccaaatccaggttctagcacagacggcaacagcgccggacattcggggaacaacatcctcggttccgaagtggccttatttgcagggattgcttcaggatgcatcatcttcatcgtcatcatcatcacgctggtggtcctcttgctgaagtaccggaggagacacaggaagcactcgccgcagcacacgaccacgctgtcgctcagcacactggccacacccaagcgcagcggcaacaacaacggctcagagcccagtgacattatcatcccgctaaggactgcggacagcgtcttctgccctcactacgagaaggtcagcggggactacgggcacccggtgtacatcgtccaggagatgcccccgcagagcccggcgaacatttactacaaggtctga
Sequence Length
1002
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,923 Da
NCBI Official Full Name
Homo sapiens ephrin-B2, mRNA
NCBI Official Synonym Full Names
ephrin B2
NCBI Official Symbol
EFNB2
NCBI Official Synonym Symbols
HTKL; EPLG5; Htk-L; LERK5
NCBI Protein Information
ephrin-B2
UniProt Protein Name
Ephrin-B2
Protein Family
UniProt Gene Name
EFNB2
UniProt Synonym Gene Names
EPLG5; HTKL; LERK5; LERK-5; HTK-L
UniProt Entry Name
EFNB2_HUMAN

NCBI Description

This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors. [provided by RefSeq, Jul 2008]

Uniprot Description

EFNB2: a type I membrane protein of the ephrin family. A ligand of Eph-related receptor tyrosine kinases EphA3 and EphB4. Ephrins and ephrin receptors mediate numerous developmental processes, particularly in the nervous system. Ephrin-B2 is implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. May play a role in constraining the orientation of longitudinally projecting axons

Protein type: Membrane protein, integral; Ligand, receptor tyrosine kinase

Chromosomal Location of Human Ortholog: 13q33

Cellular Component: focal adhesion; integral to plasma membrane; plasma membrane

Molecular Function: ephrin receptor binding; protein binding

Biological Process: anatomical structure morphogenesis; axon guidance; cell adhesion; cell migration during sprouting angiogenesis; cell-cell signaling; ephrin receptor signaling pathway; regulation of chemotaxis

Research Articles on EFNB2

Similar Products

Product Notes

The EFNB2 efnb2 (Catalog #AAA1274360) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgtga gaagggactc cgtgtggaag tactgctggg gtgttttgat ggttttatgc agaactgcga tttccaaatc gatagtttta gagcctatct attggaattc ctcgaactcc aaatttctac ctggacaagg actggtacta tacccacaga taggagacaa attggatatt atttgcccca aagtggactc taaaactgtt ggccagtatg aatattataa agtttatatg gttgataaag accaagcaga cagatgcact attaagaagg aaaatacccc tctcctcaac tgtgccaaac cagaccaaga tatcaaattc accatcaagt ttcaagaatt cagccctaac ctctggggtc tagaatttca gaagaacaaa gattattaca ttatatctac atcaaatggg tctttggagg gcctggataa ccaggaggga ggggtgtgcc agacaagagc catgaagatc ctcatgaaag ttggacaaga tgcaagttct gctggatcaa ccaggaataa agatccaaca agacgtccag aactagaagc tggtacaaat ggaagaagtt cgacaacaag tccctttgta aaaccaaatc caggttctag cacagacggc aacagcgccg gacattcggg gaacaacatc ctcggttccg aagtggcctt atttgcaggg attgcttcag gatgcatcat cttcatcgtc atcatcatca cgctggtggt cctcttgctg aagtaccgga ggagacacag gaagcactcg ccgcagcaca cgaccacgct gtcgctcagc acactggcca cacccaagcg cagcggcaac aacaacggct cagagcccag tgacattatc atcccgctaa ggactgcgga cagcgtcttc tgccctcact acgagaaggt cagcggggac tacgggcacc cggtgtacat cgtccaggag atgcccccgc agagcccggc gaacatttac tacaaggtct ga. It is sometimes possible for the material contained within the vial of "EFNB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.