Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EFEMP1 cdna clone

EFEMP1 cDNA Clone

Gene Names
EFEMP1; DHRD; DRAD; FBNL; MLVT; MTLV; S1-5; FBLN3; FIBL-3
Synonyms
EFEMP1; EFEMP1 cDNA Clone; EFEMP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttgaaagcccttttcctaactatgctgactctggcgctggtcaagtcacaggacaccgaagaaaccatcacgtacacgcaatgcactgacggatatgagtgggatcctgtgagacagcaatgcaaagatattgatgaatgtgacattgtcccagacgcttgtaaaggtggaatgaagtgtgtcaaccactatggaggatacctctgccttccgaaaacagcccagattattgtcaataatgaacagcctcagcaggaaacacaaccagcagaaggaacctcaggggcaaccaccggggttgtagctgccagcagcatggcaaccagtggagtgttgcccgggggtggttttgtggccagtgctgctgcagtcgcaggccctgaaatgcagactggccgaaataactttgtcatccggcggaacccagctgaccctcagcgcattccctccaacccttcccaccgtatccagtgtgcagcaggctacgagcaaagtgaacacaacgtgtgccaagacatagacgagtgcactgcagggacgcacaactgtagagcagaccaagtgtgcatcaatttacggggatcctttgcatgtcagtgccctcctggatatcagaagcgaggggagcagtgcgtagacatagatgaatgtaccatccctccatattgccaccaaagatgcgtgaatacaccaggctcattttattgccagtgcagtcctgggtttcaattggcagcaaacaactatacctgcgtagatataaatgaatgtgatgccagcaatcaatgtgctcagcagtgctacaacattcttggttcattcatctgtcagtgcaatcaaggatatgagctaagcagtgacaggctcaactgtgaagacattgatgaatgcagaacctcaagctacctgtgtcaatatcaatgtgtcaatgaacctgggaaattctcatgtatgtgcccccagggataccaagtggtgagaagtagaacatgtcaagatataaatgagtgtgagaccacaaatgaatgccgggaggatgaaatgtgttggaattatcatggcggcttccgttgttatccacgaaatccttgtcaagatccctacattctaacaccagagaaccgatgtgtttgcccagtctcaaatgccatgtgccgagaactgccccagtcaatagtctacaaatacatgagcatccgatctgataggtctgtgccatcagacatcttccagatacaggccacaactatttatgccaacaccatcaatacttttcggattaaatctggaaatgaaaatggagagttctacctacgacaaacaagtcctgtaagtgcaatgcttgtgctcgtgaagtcattatcaggaccaagagaacatatcgtggacctggagatgctgacagtcagcagtatagggaccttccgcacaagctctgtgttaagattgacaataatagtggggccattttcattttag
Sequence Length
1482
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,195 Da
NCBI Official Full Name
Homo sapiens EGF-containing fibulin-like extracellular matrix protein 1, mRNA
NCBI Official Synonym Full Names
EGF containing fibulin like extracellular matrix protein 1
NCBI Official Symbol
EFEMP1
NCBI Official Synonym Symbols
DHRD; DRAD; FBNL; MLVT; MTLV; S1-5; FBLN3; FIBL-3
NCBI Protein Information
EGF-containing fibulin-like extracellular matrix protein 1
UniProt Protein Name
EGF-containing fibulin-like extracellular matrix protein 1
UniProt Gene Name
EFEMP1
UniProt Synonym Gene Names
FBLN3; FBNL; FIBL-3
UniProt Entry Name
FBLN3_HUMAN

NCBI Description

This gene encodes a member of the fibulin family of extracellular matrix glycoproteins. Like all members of this family, the encoded protein contains tandemly repeated epidermal growth factor-like repeats followed by a C-terminus fibulin-type domain. This gene is upregulated in malignant gliomas and may play a role in the aggressive nature of these tumors. Mutations in this gene are associated with Doyne honeycomb retinal dystrophy. Alternatively spliced transcript variants that encode the same protein have been described.[provided by RefSeq, Nov 2009]

Uniprot Description

EFEMP1: Binds EGFR, the EGF receptor, inducing EGFR autophosphorylation and the activation of downstream signaling pathways. May play a role in cell adhesion and migration. May function as a negative regulator of chondrocyte differentiation. In the olfactory epithelium, it may regulate glial cell migration, differentiation and the ability of glial cells to support neuronal neurite outgrowth. Defects in EFEMP1 are a cause of Doyne honeycomb retinal dystrophy (DHRD); also known as malattia leventinese (MLVT) (ML). DHRD is an autosomal dominant disease characterized by yellow-white deposits known as drusen that accumulate beneath the retinal pigment epithelium. Belongs to the fibulin family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 2p16

Cellular Component: extracellular matrix; extracellular region; extracellular space; proteinaceous extracellular matrix

Molecular Function: epidermal growth factor receptor activity; epidermal growth factor receptor binding; protein binding

Biological Process: camera-type eye development; embryonic eye morphogenesis; epidermal growth factor receptor signaling pathway; negative regulation of chondrocyte differentiation; peptidyl-tyrosine phosphorylation; post-embryonic eye morphogenesis; regulation of transcription, DNA-dependent; visual perception

Disease: Doyne Honeycomb Retinal Dystrophy

Research Articles on EFEMP1

Similar Products

Product Notes

The EFEMP1 efemp1 (Catalog #AAA1273587) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgaaag cccttttcct aactatgctg actctggcgc tggtcaagtc acaggacacc gaagaaacca tcacgtacac gcaatgcact gacggatatg agtgggatcc tgtgagacag caatgcaaag atattgatga atgtgacatt gtcccagacg cttgtaaagg tggaatgaag tgtgtcaacc actatggagg atacctctgc cttccgaaaa cagcccagat tattgtcaat aatgaacagc ctcagcagga aacacaacca gcagaaggaa cctcaggggc aaccaccggg gttgtagctg ccagcagcat ggcaaccagt ggagtgttgc ccgggggtgg ttttgtggcc agtgctgctg cagtcgcagg ccctgaaatg cagactggcc gaaataactt tgtcatccgg cggaacccag ctgaccctca gcgcattccc tccaaccctt cccaccgtat ccagtgtgca gcaggctacg agcaaagtga acacaacgtg tgccaagaca tagacgagtg cactgcaggg acgcacaact gtagagcaga ccaagtgtgc atcaatttac ggggatcctt tgcatgtcag tgccctcctg gatatcagaa gcgaggggag cagtgcgtag acatagatga atgtaccatc cctccatatt gccaccaaag atgcgtgaat acaccaggct cattttattg ccagtgcagt cctgggtttc aattggcagc aaacaactat acctgcgtag atataaatga atgtgatgcc agcaatcaat gtgctcagca gtgctacaac attcttggtt cattcatctg tcagtgcaat caaggatatg agctaagcag tgacaggctc aactgtgaag acattgatga atgcagaacc tcaagctacc tgtgtcaata tcaatgtgtc aatgaacctg ggaaattctc atgtatgtgc ccccagggat accaagtggt gagaagtaga acatgtcaag atataaatga gtgtgagacc acaaatgaat gccgggagga tgaaatgtgt tggaattatc atggcggctt ccgttgttat ccacgaaatc cttgtcaaga tccctacatt ctaacaccag agaaccgatg tgtttgccca gtctcaaatg ccatgtgccg agaactgccc cagtcaatag tctacaaata catgagcatc cgatctgata ggtctgtgcc atcagacatc ttccagatac aggccacaac tatttatgcc aacaccatca atacttttcg gattaaatct ggaaatgaaa atggagagtt ctacctacga caaacaagtc ctgtaagtgc aatgcttgtg ctcgtgaagt cattatcagg accaagagaa catatcgtgg acctggagat gctgacagtc agcagtatag ggaccttccg cacaagctct gtgttaagat tgacaataat agtggggcca ttttcatttt ag. It is sometimes possible for the material contained within the vial of "EFEMP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.