EDARADD cdna clone

EDARADD cDNA Clone

Cat. Num. AAA1271302

• Gene Names: EDARADD; ED3; EDA3; ECTD11A; ECTD11B
• Synonyms: EDARADD; EDARADD cDNA Clone; EDARADD cdna clone

• Sequence: ATGGGCCTCAGGACGACTAAACAGATAGGGAGAGGCACTAAAGCTCCTGGTCACCAAGAGGATCATATGGTAAAGGAACCAGTGGAAGACACAGACCCTAGCACTTTATCCTTTAATATGTCAGACAAATATCCCATTCAAGATACGGAACTCCCTAAAGCTGAAGAATGTGATACAATTACTTTGAACTGCCCACGAAATTCAGATATGAAAAATCAGGGAGAAGAAAATGGCTTTCCAGATAGCACTGGAGATCCTCTTCCAGAGATCAGCAAGGACAACTCCTGCAAAGAAAACTGTACTTGTTCCTCCTGCTTGCTCCGGGCCCCCACCATAAGTGACTTGCTCAATGATCAGGACTTACTAGATGTGATCAGGATAAAGCTGGATCCGTGTCACCCAACGGTGAAAAACTGGAGGAATTTTGCAAGCAAATGGGGGATGTCCTATGACGAATTGTGCTTCCTGGAGCAGAGGCCACAGAGCCCCACCTTGGAGTTCTTGCTCCGGAACAGTCAGAGGACGGTGGGCCAGCTGATGGAGCTCTGCAGGCTCTACCACAGGGCCGACGTGGAGAAGGTTCTGCGCAGGTGGGTGGACGAGGAGTGGCCCAAGCGGGAGCGTGGAGACCCCTCCAGGCACTTCTAG
• Sequence Length: 648

• Vector: Please Inquire

NCBI and Uniprot Product Information

• NCBI GI #: 124504411
• NCBI GeneID: 128178
• Molecular Weight: 23,690 Da
• NCBI Official Full Name: Homo sapiens EDAR-associated death domain, mRNA
• NCBI Official Synonym Full Names: EDAR associated death domain
• NCBI Official Symbol: EDARADD
• NCBI Official Synonym Symbols: ED3; EDA3; ECTD11A; ECTD11B
• NCBI Protein Information: ectodysplasin-A receptor-associated adapter protein
• UniProt Protein Name: Ectodysplasin-A receptor-associated adapter protein
• Protein Family: Ectodysplasin-A receptor-associated adapter protein
• UniProt Gene Name: EDARADD
• UniProt Entry Name: EDAD_HUMAN

NCBI Description

This gene was identified by its association with ectodermal dysplasia, a genetic disorder characterized by defective development of hair, teeth, and eccrine sweat glands. The protein encoded by this gene is a death domain-containing protein, and is found to interact with EDAR, a death domain receptor known to be required for the development of hair, teeth and other ectodermal derivatives. This protein and EDAR are coexpressed in epithelial cells during the formation of hair follicles and teeth. Through its interaction with EDAR, this protein acts as an adaptor, and links the receptor to downstream signaling pathways. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

EDARADD: Adapter protein that interacts with EDAR DEATH domain and couples the receptor to EDA signaling pathway during morphogenesis of ectodermal organs. Mediates the activation of NF- kappa-B. Defects in EDARADD are a cause of ectodermal dysplasia anhidrotic (EDA); also known ectodermal dysplasia hypohidrotic autosomal recessive (HED). Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EDA is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 1q42.3

Cellular Component: cytosol

Molecular Function: protein binding

Biological Process: tumor necrosis factor-mediated signaling pathway

Disease: Ectodermal Dysplasia 10a, Hypohidrotic/hair/nail Type, Autosomal Dominant; Ectodermal Dysplasia 10b, Hypohidrotic/hair/tooth Type, Autosomal Recessive; Ectodermal Dysplasia 11a, Hypohidrotic/hair/tooth Type, Autosomal Dominant; Ectodermal Dysplasia 11b, Hypohidrotic/hair/tooth Type, Autosomal Recessive