Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EBI3 cdna clone

EBI3 cDNA Clone

Gene Names
EBI3; IL27B; IL-27B
Synonyms
EBI3; EBI3 cDNA Clone; EBI3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccccgcagcttctcctggcccttgtcctctgggccagctgcccgccctgcagtggaaggaaagggcccccagcagctctgacactgccccgggtgcaatgccgagcctctcggtacccgatcgccgtggattgctcctggaccctgccgcctgctccaaactccaccagccccgtgtccttcattgccacgtacaggctcggcatggctgcccggggccacagctggccctgcctgcagcagacgccaacgtccaccagctgcaccatcacggatgtccagctgttctccatggctccctacgtgctcaatgtcaccgccgtccacccctggggctccagcagcagcttcgtgcctttcataacagagcacatcatcaagcccgaccctccagaaggcgtgcgcctaagccccctcgctgagcgccagctacaggtgcagtgggagcctcccgggtcctggcccttcccagagatcttctcactgaagtactggatccgttacaagcgtcagggagctgcgcgcttccaccgggtggggcccattgaagccacgtccttcatcctcagggctgtgcggccccgagccaggtactacgtccaagtggcggctcaggacctcacagactacggggaactgagtgactggagtctccccgccactgccacaatgagcctgggcaagtag
Sequence Length
690
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,396 Da
NCBI Official Full Name
Homo sapiens Epstein-Barr virus induced 3, mRNA
NCBI Official Synonym Full Names
Epstein-Barr virus induced 3
NCBI Official Symbol
EBI3
NCBI Official Synonym Symbols
IL27B; IL-27B
NCBI Protein Information
interleukin-27 subunit beta
UniProt Protein Name
Interleukin-27 subunit beta
Protein Family
UniProt Gene Name
EBI3
UniProt Synonym Gene Names
IL27B; IL-27 subunit beta; IL-27B; EBV-induced gene 3 protein
UniProt Entry Name
IL27B_HUMAN

NCBI Description

This gene was identified by its induced expression in B lymphocytes in response Epstein-Barr virus infection. It encodes a secreted glycoprotein belonging to the hematopoietin receptor family, and heterodimerizes with a 28 kDa protein to form interleukin 27 (IL-27). IL-27 regulates T cell and inflammatory responses, in part by activating the Jak/STAT pathway of CD4+ T cells. [provided by RefSeq, Sep 2008]

Uniprot Description

IL27-beta: Cytokine with pro- and anti-inflammatory properties, that can regulate T-helper cell development, suppress T-cell proliferation, stimulate cytotoxic T-cell activity, induce isotype switching in B-cells, and that has diverse effects on innate immune cells. Among its target cells are CD4 T-helper cells which can differentiate in type 1 effector cells (TH1), type 2 effector cells (TH2) and IL17 producing helper T-cells (TH17). It drives rapid clonal expansion of naive but not memory CD4 T-cells. It also strongly synergizes with IL-12 to trigger interferon- gamma/IFN-gamma production of naive CD4 T-cells, binds to the cytokine receptor WSX-1/TCCR. Another important role of IL27 is its antitumor activity as well as its antiangiogenic activity with activation of production of antiangiogenic chemokines. Belongs to the type I cytokine receptor family. Type 3 subfamily.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: extracellular region; plasma membrane

Molecular Function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; protein binding

Biological Process: humoral immune response; positive regulation of alpha-beta T cell proliferation; positive regulation of interferon-gamma biosynthetic process; T-helper 1 type immune response

Research Articles on EBI3

Similar Products

Product Notes

The EBI3 ebi3 (Catalog #AAA1269899) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccccgc agcttctcct ggcccttgtc ctctgggcca gctgcccgcc ctgcagtgga aggaaagggc ccccagcagc tctgacactg ccccgggtgc aatgccgagc ctctcggtac ccgatcgccg tggattgctc ctggaccctg ccgcctgctc caaactccac cagccccgtg tccttcattg ccacgtacag gctcggcatg gctgcccggg gccacagctg gccctgcctg cagcagacgc caacgtccac cagctgcacc atcacggatg tccagctgtt ctccatggct ccctacgtgc tcaatgtcac cgccgtccac ccctggggct ccagcagcag cttcgtgcct ttcataacag agcacatcat caagcccgac cctccagaag gcgtgcgcct aagccccctc gctgagcgcc agctacaggt gcagtgggag cctcccgggt cctggccctt cccagagatc ttctcactga agtactggat ccgttacaag cgtcagggag ctgcgcgctt ccaccgggtg gggcccattg aagccacgtc cttcatcctc agggctgtgc ggccccgagc caggtactac gtccaagtgg cggctcagga cctcacagac tacggggaac tgagtgactg gagtctcccc gccactgcca caatgagcct gggcaagtag. It is sometimes possible for the material contained within the vial of "EBI3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.